Transcript: Human NM_021996.6

Homo sapiens globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 (FORS blood group) (GBGT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
GBGT1 (26301)
Length:
1954
CDS:
282..1325

Additional Resources:

NCBI RefSeq record:
NM_021996.6
NBCI Gene record:
GBGT1 (26301)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021996.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372286 ATTGCCCTTAACGTAGCATTT pLKO_005 1681 3UTR 100% 10.800 15.120 N GBGT1 n/a
2 TRCN0000036288 GCCAGGGTATATGAGTTTACT pLKO.1 1089 CDS 100% 5.625 7.875 N GBGT1 n/a
3 TRCN0000372339 GTACCGGGTGCACTACTACAT pLKO_005 698 CDS 100% 0.000 0.000 N GBGT1 n/a
4 TRCN0000372338 CCCAACCACATGTAGCCAATT pLKO_005 1774 3UTR 100% 10.800 7.560 N GBGT1 n/a
5 TRCN0000036284 CCGTCACTTCATCTCAAACAA pLKO.1 1187 CDS 100% 5.625 3.938 N GBGT1 n/a
6 TRCN0000036286 CCTGTGGGTGTATCTTGAGAA pLKO.1 347 CDS 100% 4.950 3.465 N GBGT1 n/a
7 TRCN0000036287 CTTCTGCCTTGATGTGGACAT pLKO.1 887 CDS 100% 4.050 2.835 N GBGT1 n/a
8 TRCN0000036285 GCCCGTGGTATGGTCACAGTA pLKO.1 458 CDS 100% 1.650 1.155 N GBGT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021996.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08014 pDONR223 100% 99.8% 99.7% None 58C>T;987C>T n/a
2 ccsbBroad304_08014 pLX_304 0% 99.8% 99.7% V5 58C>T;987C>T n/a
3 TRCN0000479602 CCTATTCGAATTCCTTACTCGTTT pLX_317 33.8% 99.8% 99.7% V5 58C>T;987C>T n/a
Download CSV