Transcript: Mouse NM_022015.3

Mus musculus TATA-box binding protein associated factor 8 (Taf8), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Taf8 (63856)
Length:
2779
CDS:
19..945

Additional Resources:

NCBI RefSeq record:
NM_022015.3
NBCI Gene record:
Taf8 (63856)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348090 GGATCCCTCTCGCTGATATAA pLKO_005 1305 3UTR 100% 15.000 21.000 N Taf8 n/a
2 TRCN0000348091 CGAGGAGAGCGTCATCGATAA pLKO_005 867 CDS 100% 10.800 15.120 N Taf8 n/a
3 TRCN0000084350 CGTGGTCACATTGGTTGAAAT pLKO.1 291 CDS 100% 13.200 10.560 N Taf8 n/a
4 TRCN0000348089 AGAGAACAACGCTCTTCATAT pLKO_005 765 CDS 100% 13.200 9.240 N Taf8 n/a
5 TRCN0000348153 TTGCTGACAGAGGCGGGATTT pLKO_005 142 CDS 100% 10.800 7.560 N Taf8 n/a
6 TRCN0000084352 GATACAGAGAACAACGCTCTT pLKO.1 760 CDS 100% 4.050 2.835 N Taf8 n/a
7 TRCN0000084351 CTGGAGATACAGCAGATGGAA pLKO.1 706 CDS 100% 3.000 2.100 N Taf8 n/a
8 TRCN0000084349 GCAGAGCTACATCTCAGAAAT pLKO.1 207 CDS 100% 13.200 7.920 N Taf8 n/a
9 TRCN0000333930 GCAGAGCTACATCTCAGAAAT pLKO_005 207 CDS 100% 13.200 7.920 N Taf8 n/a
10 TRCN0000084348 GCCTCTCAAATGGTAGGCAAT pLKO.1 2557 3UTR 100% 4.050 2.430 N Taf8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13147 pDONR223 100% 88.1% 93.2% None (many diffs) n/a
2 ccsbBroad304_13147 pLX_304 0% 88.1% 93.2% V5 (many diffs) n/a
3 TRCN0000467148 TTCCATGCTATTCTTCTTCCACAT pLX_317 16.2% 88.1% 93.2% V5 (many diffs) n/a
4 ccsbBroadEn_13146 pDONR223 100% 50.8% 51.2% None (many diffs) n/a
5 ccsbBroad304_13146 pLX_304 0% 50.8% 51.2% V5 (many diffs) n/a
6 TRCN0000473773 CGGGTATGAAGAAAAACTTAAGCG pLX_317 87.2% 50.8% 51.2% V5 (many diffs) n/a
Download CSV