Transcript: Human NM_022054.4

Homo sapiens potassium two pore domain channel subfamily K member 13 (KCNK13), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
KCNK13 (56659)
Length:
2289
CDS:
213..1439

Additional Resources:

NCBI RefSeq record:
NM_022054.4
NBCI Gene record:
KCNK13 (56659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022054.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437073 ATGACAACTCCGGCGACAGTA pLKO_005 555 CDS 100% 4.950 6.930 N KCNK13 n/a
2 TRCN0000044678 CGTGTACTACGTCATGCTGAT pLKO.1 791 CDS 100% 4.050 5.670 N KCNK13 n/a
3 TRCN0000044682 CGTCGTTTCCACCATAGGGTT pLKO.1 530 CDS 100% 2.640 3.696 N KCNK13 n/a
4 TRCN0000065523 CCATAGGGTTTGGGATGACAA pLKO.1 541 CDS 100% 4.950 3.960 N Kcnk13 n/a
5 TRCN0000422897 CATTGCCTTGTTTCATTAATC pLKO_005 1710 3UTR 100% 13.200 9.240 N KCNK13 n/a
6 TRCN0000419381 GCTTGTCTCCTGATCCTTATT pLKO_005 1637 3UTR 100% 13.200 9.240 N KCNK13 n/a
7 TRCN0000418215 GAGTAGAATGGAGGATGATTG pLKO_005 1470 3UTR 100% 10.800 7.560 N KCNK13 n/a
8 TRCN0000044679 CCTCATCAAACAGTCCTTGAA pLKO.1 1055 CDS 100% 4.950 3.465 N KCNK13 n/a
9 TRCN0000044680 GATCACCATCATCGCCTACAT pLKO.1 659 CDS 100% 4.950 3.465 N KCNK13 n/a
10 TRCN0000044681 GATGATCTCCATGAAGGACTT pLKO.1 1247 CDS 100% 4.050 2.835 N KCNK13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022054.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03735 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03735 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475387 TCGCTGTCTTGCGATACCTTTGAG pLX_317 29.2% 100% 100% V5 n/a
Download CSV