Transcript: Human NM_022061.4

Homo sapiens mitochondrial ribosomal protein L17 (MRPL17), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
MRPL17 (63875)
Length:
2305
CDS:
45..572

Additional Resources:

NCBI RefSeq record:
NM_022061.4
NBCI Gene record:
MRPL17 (63875)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022061.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154260 CCCTTAATCAGTACCCATGAT pLKO.1 594 3UTR 100% 4.950 6.930 N MRPL17 n/a
2 TRCN0000280995 CCCTTAATCAGTACCCATGAT pLKO_005 594 3UTR 100% 4.950 6.930 N MRPL17 n/a
3 TRCN0000154177 CCCAAAGCTGTTTCAAGTACT pLKO.1 302 CDS 100% 4.950 3.465 N MRPL17 n/a
4 TRCN0000154258 CCTCGGTACAAAGATCAAACT pLKO.1 327 CDS 100% 4.950 3.465 N MRPL17 n/a
5 TRCN0000281061 CCTCGGTACAAAGATCAAACT pLKO_005 327 CDS 100% 4.950 3.465 N MRPL17 n/a
6 TRCN0000157192 GCAGATCCCAAATCGGAGTTT pLKO.1 368 CDS 100% 4.950 3.465 N MRPL17 n/a
7 TRCN0000297927 GCAGATCCCAAATCGGAGTTT pLKO_005 368 CDS 100% 4.950 3.465 N MRPL17 n/a
8 TRCN0000154259 CTACACAAGAATGCTGCAGAT pLKO.1 353 CDS 100% 4.050 2.835 N MRPL17 n/a
9 TRCN0000153985 CAGAGAAGGATTTGATCCCAA pLKO.1 286 CDS 100% 2.640 1.848 N MRPL17 n/a
10 TRCN0000281059 CAGAGAAGGATTTGATCCCAA pLKO_005 286 CDS 100% 2.640 1.848 N MRPL17 n/a
11 TRCN0000156801 GAAGCTCATCGACTATGGGAA pLKO.1 215 CDS 100% 2.640 1.848 N MRPL17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022061.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08808 pDONR223 100% 99.8% 99.4% None 520G>C n/a
2 ccsbBroad304_08808 pLX_304 0% 99.8% 99.4% V5 520G>C n/a
3 TRCN0000468987 TGCGTAGTGGTGGACTTACTCTGC pLX_317 85.6% 99.8% 99.4% V5 520G>C n/a
Download CSV