Transcript: Human NM_022106.3

Homo sapiens family with sequence similarity 217 member B (FAM217B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FAM217B (63939)
Length:
5086
CDS:
350..1501

Additional Resources:

NCBI RefSeq record:
NM_022106.3
NBCI Gene record:
FAM217B (63939)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022106.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421628 ATGCACGTAAGTATATGAAAT pLKO_005 1866 3UTR 100% 13.200 18.480 N FAM217B n/a
2 TRCN0000137495 GATCTCAATCTTCGAGCTGAA pLKO.1 689 CDS 100% 4.050 5.670 N FAM217B n/a
3 TRCN0000422475 ATTGATCCAGTTTACTTTGAT pLKO_005 713 CDS 100% 5.625 4.500 N FAM217B n/a
4 TRCN0000412929 GAAATCCACCCATCACATTAT pLKO_005 1115 CDS 100% 13.200 9.240 N FAM217B n/a
5 TRCN0000424238 CAAATGGTGTGGAATCCTAAA pLKO_005 1901 3UTR 100% 10.800 7.560 N FAM217B n/a
6 TRCN0000138411 CCCTGGGAGAAGTAAGCTAAT pLKO.1 1009 CDS 100% 10.800 7.560 N FAM217B n/a
7 TRCN0000136681 GAAGAAATCCACCCATCACAT pLKO.1 1112 CDS 100% 4.950 3.465 N FAM217B n/a
8 TRCN0000138172 GCTTCTGAACGCAGAGAACAA pLKO.1 829 CDS 100% 4.950 3.465 N FAM217B n/a
9 TRCN0000133750 CCTTCTTATTTCACTGCAGTT pLKO.1 2618 3UTR 100% 4.050 2.835 N FAM217B n/a
10 TRCN0000428835 GTGATCTCTCTGATTCGGAAA pLKO_005 633 CDS 100% 4.050 2.835 N FAM217B n/a
11 TRCN0000138366 CCGTCATGTATCCATGTGCAT pLKO.1 3504 3UTR 100% 2.640 1.848 N FAM217B n/a
12 TRCN0000137177 GAGGACTTCTTGGGAAGTATA pLKO.1 873 CDS 100% 1.320 0.924 N FAM217B n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3650 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3651 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022106.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03911 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03911 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469824 AGATTTTTTCAGATCACCTAAATG pLX_317 39.7% 100% 100% V5 n/a
Download CSV