Transcript: Human NM_022119.4

Homo sapiens serine protease 22 (PRSS22), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PRSS22 (64063)
Length:
1383
CDS:
67..1020

Additional Resources:

NCBI RefSeq record:
NM_022119.4
NBCI Gene record:
PRSS22 (64063)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022119.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046638 GTTCCTATCATCGACTCGGAA pLKO.1 664 CDS 100% 2.640 3.696 N PRSS22 n/a
2 TRCN0000046640 GATCGTGAGCATCCAGAAGAA pLKO.1 255 CDS 100% 4.950 3.465 N PRSS22 n/a
3 TRCN0000046639 CCTGAACAAACCATACCTGTT pLKO.1 351 CDS 100% 4.050 2.835 N PRSS22 n/a
4 TRCN0000422415 TCCACATCTGGATCTGGATCT pLKO_005 1063 3UTR 100% 4.050 2.835 N PRSS22 n/a
5 TRCN0000413411 CATCCAAGATGGAGTTCCCTT pLKO_005 612 CDS 100% 2.640 1.848 N PRSS22 n/a
6 TRCN0000046642 GCGCTCCATACAGTTCTCAGA pLKO.1 510 CDS 100% 2.640 1.848 N PRSS22 n/a
7 TRCN0000046641 GCACCGCTCCTGGGTGGAGAA pLKO.1 906 CDS 100% 0.000 0.000 N PRSS22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022119.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03916 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03916 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468505 CTATCTTGCTAGGTAATTAGATTA pLX_317 39.8% 100% 100% V5 n/a
Download CSV