Transcript: Human NM_022168.4

Homo sapiens interferon induced with helicase C domain 1 (IFIH1), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
IFIH1 (64135)
Length:
3581
CDS:
378..3455

Additional Resources:

NCBI RefSeq record:
NM_022168.4
NBCI Gene record:
IFIH1 (64135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022168.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232950 TTCGAATGATAGATGCGTATA pLKO_005 2227 CDS 100% 10.800 15.120 N IFIH1 n/a
2 TRCN0000050848 CGCAAGGAGTTCCAACCATTT pLKO.1 1497 CDS 100% 10.800 8.640 N IFIH1 n/a
3 TRCN0000050850 CCATCGTTTGAGAACGCTCAT pLKO.1 690 CDS 100% 4.050 3.240 N IFIH1 n/a
4 TRCN0000232948 ATAACATCATGAGGCATTATT pLKO_005 1741 CDS 100% 15.000 10.500 N IFIH1 n/a
5 TRCN0000232951 AGGAATCAGCACGAGGAATAA pLKO_005 2524 CDS 100% 13.200 9.240 N IFIH1 n/a
6 TRCN0000232947 AGGTGTAAGAGAGCTACTAAA pLKO_005 863 CDS 100% 13.200 9.240 N IFIH1 n/a
7 TRCN0000050849 CCAACAAAGAAGCAGTGTATA pLKO.1 1720 CDS 100% 13.200 9.240 N IFIH1 n/a
8 TRCN0000232949 GTACAATGAGGCCCTACAAAT pLKO_005 2195 CDS 100% 13.200 9.240 N IFIH1 n/a
9 TRCN0000050851 CCCAGAATTCAAGGAACTTTA pLKO.1 3173 CDS 100% 0.000 0.000 N IFIH1 n/a
10 TRCN0000050852 CCCATGACACAGAATGAACAA pLKO.1 2670 CDS 100% 4.950 2.970 N IFIH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022168.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08839 pDONR223 100% 99.9% 99.8% None 2528A>G;2836G>A n/a
2 ccsbBroad304_08839 pLX_304 0% 99.9% 99.8% V5 2528A>G;2836G>A n/a
3 ccsbBroadEn_12450 pDONR223 100% 21.2% 20.4% None (many diffs) n/a
4 ccsbBroad304_12450 pLX_304 0% 21.2% 20.4% V5 (many diffs) n/a
5 TRCN0000469927 TGTAGGTGAACGGGTATCTCTATT pLX_317 59.7% 21.2% 20.4% V5 (many diffs) n/a
Download CSV