Transcript: Human NM_022171.2

Homo sapiens T cell leukemia translocation altered (TCTA), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
TCTA (6988)
Length:
2172
CDS:
222..533

Additional Resources:

NCBI RefSeq record:
NM_022171.2
NBCI Gene record:
TCTA (6988)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122396 GAATACAGTGACCGGGTTGTA pLKO.1 404 CDS 100% 4.950 6.930 N TCTA n/a
2 TRCN0000141199 CCTACTTCCTTCCTGTTGGAT pLKO.1 1937 3UTR 100% 3.000 2.100 N TCTA n/a
3 TRCN0000142431 GCTGTGGTTGGTGTTAAGTCT pLKO.1 350 CDS 100% 3.000 2.100 N TCTA n/a
4 TRCN0000375936 GAGAATAAGGGAAGGCAGCAG pLKO_005 526 CDS 100% 2.160 1.512 N Tcta n/a
5 TRCN0000141381 CATTTCCCTTCGTGGGAAATG pLKO.1 477 CDS 100% 1.080 0.756 N TCTA n/a
6 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 925 3UTR 100% 4.950 2.475 Y GJD4 n/a
7 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 925 3UTR 100% 4.950 2.475 Y C9orf85 n/a
8 TRCN0000142544 GCAGGAGATTTGCTTGAACCT pLKO.1 1091 3UTR 100% 2.640 1.320 Y TCTA n/a
9 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 991 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01654 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01654 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475248 TGGCGGGTGCACAAAGTCTATTCA pLX_317 100% 100% 100% V5 n/a
Download CSV