Transcript: Human NM_022338.4

Homo sapiens chromosome 11 open reading frame 24 (C11orf24), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
C11orf24 (53838)
Length:
2071
CDS:
415..1764

Additional Resources:

NCBI RefSeq record:
NM_022338.4
NBCI Gene record:
C11orf24 (53838)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022338.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072732 GCCCACCTCAACTCTATGGAA pLKO.1 628 CDS 100% 3.000 4.200 N C11orf24 n/a
2 TRCN0000307740 GCCCACCTCAACTCTATGGAA pLKO_005 628 CDS 100% 3.000 4.200 N C11orf24 n/a
3 TRCN0000072729 CGCAACTTTGTCCCTAACAAA pLKO.1 490 CDS 100% 0.563 0.788 N C11orf24 n/a
4 TRCN0000291571 CGCAACTTTGTCCCTAACAAA pLKO_005 490 CDS 100% 0.563 0.788 N C11orf24 n/a
5 TRCN0000072731 CCAGGTGGACTACTTAATCAA pLKO.1 1716 CDS 100% 5.625 4.500 N C11orf24 n/a
6 TRCN0000291569 CCAGGTGGACTACTTAATCAA pLKO_005 1716 CDS 100% 5.625 4.500 N C11orf24 n/a
7 TRCN0000072730 GCCTGTGGTTAACACAACAAA pLKO.1 1206 CDS 100% 5.625 3.938 N C11orf24 n/a
8 TRCN0000307742 GCCTGTGGTTAACACAACAAA pLKO_005 1206 CDS 100% 5.625 3.938 N C11orf24 n/a
9 TRCN0000193919 CTATGAGAGCTACAAGAAGAA pLKO.1 1686 CDS 100% 4.950 3.465 N 1810055G02Rik n/a
10 TRCN0000328039 CTATGAGAGCTACAAGAAGAA pLKO_005 1686 CDS 100% 4.950 3.465 N 1810055G02Rik n/a
11 TRCN0000072728 CCAGATGCTTAAACACATTTA pLKO.1 1874 3UTR 100% 13.200 7.920 N C11orf24 n/a
12 TRCN0000291627 CCAGATGCTTAAACACATTTA pLKO_005 1874 3UTR 100% 13.200 7.920 N C11orf24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022338.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08354 pDONR223 100% 99.9% 99.7% None 290G>T n/a
2 ccsbBroad304_08354 pLX_304 0% 99.9% 99.7% V5 290G>T n/a
3 TRCN0000466751 GCTCAAAGCGCTCAACTACCAATA pLX_317 28.7% 99.9% 99.7% V5 290G>T n/a
Download CSV