Transcript: Human NM_022367.4

Homo sapiens semaphorin 4A (SEMA4A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SEMA4A (64218)
Length:
3242
CDS:
210..2495

Additional Resources:

NCBI RefSeq record:
NM_022367.4
NBCI Gene record:
SEMA4A (64218)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022367.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058136 GCTCTATTCTGGTACTATGAA pLKO.1 785 CDS 100% 5.625 7.875 N SEMA4A n/a
2 TRCN0000058135 CGAGCCAACTGTAGTGTCTAT pLKO.1 1689 CDS 100% 4.950 6.930 N SEMA4A n/a
3 TRCN0000424636 ATGAACACCAAACATCTAAAC pLKO_005 2865 3UTR 100% 10.800 7.560 N SEMA4A n/a
4 TRCN0000421567 GACCTTCATGAAGGACCATTT pLKO_005 1376 CDS 100% 10.800 7.560 N SEMA4A n/a
5 TRCN0000058133 GCCAGCGAGTTTGACTTCTTT pLKO.1 960 CDS 100% 5.625 3.938 N SEMA4A n/a
6 TRCN0000058134 GCCTCTTATTATTGGAGTCAT pLKO.1 1968 CDS 100% 4.950 3.465 N SEMA4A n/a
7 TRCN0000058137 GCCTTCTCTCTCTTGGACATT pLKO.1 1227 CDS 100% 4.950 3.465 N SEMA4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022367.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08844 pDONR223 100% 99.9% 100% None 1716C>T n/a
2 ccsbBroad304_08844 pLX_304 0% 99.9% 100% V5 1716C>T n/a
3 TRCN0000466432 CCGTTCGTGAGCCTCGAGTCACGG pLX_317 16.6% 99.9% 100% V5 1716C>T n/a
Download CSV