Transcript: Mouse NM_022408.2

Mus musculus DiGeorge syndrome critical region gene 14 (Dgcr14), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Dgcr14 (27886)
Length:
2836
CDS:
44..1486

Additional Resources:

NCBI RefSeq record:
NM_022408.2
NBCI Gene record:
Dgcr14 (27886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022408.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123620 GCCGAGACAGATAGTACATAA pLKO.1 775 CDS 100% 13.200 18.480 N Dgcr14 n/a
2 TRCN0000324313 GCCGAGACAGATAGTACATAA pLKO_005 775 CDS 100% 13.200 18.480 N Dgcr14 n/a
3 TRCN0000123619 CCACAAATATCTAGTGTTGTT pLKO.1 1611 3UTR 100% 4.950 3.960 N Dgcr14 n/a
4 TRCN0000324312 CCACAAATATCTAGTGTTGTT pLKO_005 1611 3UTR 100% 4.950 3.960 N Dgcr14 n/a
5 TRCN0000123622 GAGAAGCGACAGAAAGATAAT pLKO.1 620 CDS 100% 13.200 9.240 N Dgcr14 n/a
6 TRCN0000324243 GAGAAGCGACAGAAAGATAAT pLKO_005 620 CDS 100% 13.200 9.240 N Dgcr14 n/a
7 TRCN0000123621 CCTGGATGAAGAAGAGTACAT pLKO.1 163 CDS 100% 4.950 3.465 N Dgcr14 n/a
8 TRCN0000324244 CCTGGATGAAGAAGAGTACAT pLKO_005 163 CDS 100% 4.950 3.465 N Dgcr14 n/a
9 TRCN0000123623 GAAGAGTACATCGAGGGACTT pLKO.1 173 CDS 100% 4.050 2.835 N Dgcr14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022408.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01872 pDONR223 100% 85.7% 92.5% None (many diffs) n/a
2 ccsbBroad304_01872 pLX_304 0% 85.7% 92.5% V5 (many diffs) n/a
3 TRCN0000479383 ACCGCCCAAGATGCCGCATAAGAC pLX_317 12.5% 85.7% 92.5% V5 (many diffs) n/a
Download CSV