Transcript: Human NM_022481.6

Homo sapiens ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 (ARAP3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ARAP3 (64411)
Length:
5258
CDS:
76..4710

Additional Resources:

NCBI RefSeq record:
NM_022481.6
NBCI Gene record:
ARAP3 (64411)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022481.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369919 GGGAATCCGCAAGAAGTTAAA pLKO_005 3915 CDS 100% 13.200 18.480 N ARAP3 n/a
2 TRCN0000364988 TGGACCACCAGCATCCTTAAA pLKO_005 4021 CDS 100% 13.200 18.480 N ARAP3 n/a
3 TRCN0000047344 GTCTGGAGTAATGAGATAGTA pLKO.1 1723 CDS 100% 5.625 7.875 N ARAP3 n/a
4 TRCN0000047345 AGCCCTAAATACTGTGGAGAT pLKO.1 516 CDS 100% 4.050 5.670 N ARAP3 n/a
5 TRCN0000047347 GTGATACCTTTGACTGCCATT pLKO.1 1066 CDS 100% 4.050 5.670 N ARAP3 n/a
6 TRCN0000369918 AGAGGCCTGGGTGATGTTAAA pLKO_005 5107 3UTR 100% 13.200 9.240 N ARAP3 n/a
7 TRCN0000369917 GACCTCATCATGGAAGTTTAT pLKO_005 3427 CDS 100% 13.200 9.240 N ARAP3 n/a
8 TRCN0000364939 GCAGAAATGTGCGGCTCTAAA pLKO_005 3198 CDS 100% 13.200 9.240 N ARAP3 n/a
9 TRCN0000047343 CCCAGATAAGAAAGAGCATTT pLKO.1 2670 CDS 100% 10.800 7.560 N ARAP3 n/a
10 TRCN0000364940 CCCTCAGTACCCAGATCATAG pLKO_005 1896 CDS 100% 10.800 7.560 N ARAP3 n/a
11 TRCN0000047346 CAGTCTTATCACCACCTGGAA pLKO.1 3381 CDS 100% 2.640 1.848 N ARAP3 n/a
12 TRCN0000295677 CTCCGGCTGGAAGGTGTATAT pLKO_005 2878 CDS 100% 13.200 18.480 N Arap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022481.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12469 pDONR223 100% 4.7% 1% None 1_3931del;4154_4632del n/a
2 ccsbBroad304_12469 pLX_304 0% 4.7% 1% V5 1_3931del;4154_4632del n/a
3 TRCN0000467121 TACAGAGCGCGACATTTACCCTTA pLX_317 100% 4.7% 1% V5 1_3931del;4154_4632del n/a
Download CSV