Transcript: Human NM_022494.3

Homo sapiens zinc finger DHHC-type containing 6 (ZDHHC6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-29
Taxon:
Homo sapiens (human)
Gene:
ZDHHC6 (64429)
Length:
2170
CDS:
425..1666

Additional Resources:

NCBI RefSeq record:
NM_022494.3
NBCI Gene record:
ZDHHC6 (64429)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022494.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365338 GTGCCCTAGTGCCATGATTTA pLKO_005 1781 3UTR 100% 13.200 18.480 N ZDHHC6 n/a
2 TRCN0000370451 TGCACCGAAGAGCCTCGAATA pLKO_005 1451 CDS 100% 10.800 15.120 N ZDHHC6 n/a
3 TRCN0000365337 TTAGCACCACTGGGTTGTATC pLKO_005 872 CDS 100% 10.800 15.120 N ZDHHC6 n/a
4 TRCN0000160415 CCCTCTGAATAAAGGAATCAA pLKO.1 1411 CDS 100% 5.625 7.875 N ZDHHC6 n/a
5 TRCN0000160734 CCTTGGGATTAGCTTTAGGAA pLKO.1 1050 CDS 100% 3.000 4.200 N ZDHHC6 n/a
6 TRCN0000365339 GGTTTACGATACTGGTTATAT pLKO_005 1508 CDS 100% 15.000 12.000 N ZDHHC6 n/a
7 TRCN0000365405 AGTCAGAAGTGTTCGCTATAA pLKO_005 1360 CDS 100% 13.200 10.560 N ZDHHC6 n/a
8 TRCN0000160302 CCTAGTGCCATGATTTAAATA pLKO.1 1785 3UTR 100% 15.000 10.500 N ZDHHC6 n/a
9 TRCN0000365335 AGGAACTTTAAACAGGTATTT pLKO_005 1232 CDS 100% 13.200 9.240 N ZDHHC6 n/a
10 TRCN0000370450 CATTTCATCCAAGTAAGTTAA pLKO_005 1901 3UTR 100% 13.200 9.240 N ZDHHC6 n/a
11 TRCN0000370449 TTTGCCTTGGGATTAGCTTTA pLKO_005 1046 CDS 100% 10.800 7.560 N ZDHHC6 n/a
12 TRCN0000160472 CCTCTGAATAAAGGAATCAAA pLKO.1 1412 CDS 100% 5.625 3.938 N ZDHHC6 n/a
13 TRCN0000159002 GATACCATGTATCTCCAGTAT pLKO.1 704 CDS 100% 4.950 3.465 N ZDHHC6 n/a
14 TRCN0000159681 GTTGATAAATTGGACTGTCAT pLKO.1 604 CDS 100% 4.950 3.465 N ZDHHC6 n/a
15 TRCN0000012172 CCTTACATACAACTGGAGGAA pLKO.1 567 CDS 100% 2.640 1.848 N Zdhhc6 n/a
16 TRCN0000160416 CCCTCAGTTGATATTTCTTAT pLKO.1 2026 3UTR 100% 13.200 7.920 N ZDHHC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022494.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12473 pDONR223 100% 99% 99% None 267_278del n/a
2 ccsbBroad304_12473 pLX_304 0% 99% 99% V5 267_278del n/a
3 TRCN0000470924 AGTTTCAAGACGTGTTTGATTCTT pLX_317 42.1% 99% 99% V5 267_278del n/a
Download CSV