Transcript: Human NM_022568.4

Homo sapiens aldehyde dehydrogenase 8 family member A1 (ALDH8A1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ALDH8A1 (64577)
Length:
2534
CDS:
49..1512

Additional Resources:

NCBI RefSeq record:
NM_022568.4
NBCI Gene record:
ALDH8A1 (64577)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022568.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028423 CGAGTCTAAAGACCAAGGGAA pLKO.1 318 CDS 100% 2.640 3.696 N ALDH8A1 n/a
2 TRCN0000028476 CCACGGTGATAACAGACATTA pLKO.1 1172 CDS 100% 13.200 9.240 N ALDH8A1 n/a
3 TRCN0000028435 GACTTCTTCACTGAGATCAAA pLKO.1 1471 CDS 100% 5.625 3.938 N ALDH8A1 n/a
4 TRCN0000028465 GCATAGGTGCTCTGATAAGTA pLKO.1 1022 CDS 100% 5.625 3.938 N ALDH8A1 n/a
5 TRCN0000028396 GTTGTGCAAACTCCTGGATAA pLKO.1 615 CDS 100% 10.800 6.480 N ALDH8A1 n/a
6 TRCN0000041640 GCTACCAGAAAGTGGAAAGTT pLKO.1 976 CDS 100% 5.625 3.938 N Aldh8a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022568.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03955 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03955 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475480 CCCGTTTGCATGGGTATGTAGGTT pLX_317 22.5% 100% 100% V5 n/a
Download CSV