Transcript: Human NM_022650.2

Homo sapiens RAS p21 protein activator 1 (RASA1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
RASA1 (5921)
Length:
3796
CDS:
125..2737

Additional Resources:

NCBI RefSeq record:
NM_022650.2
NBCI Gene record:
RASA1 (5921)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022650.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231928 ACGGACCTGTCCCGTGATTTA pLKO_005 2558 CDS 100% 13.200 18.480 N RASA1 n/a
2 TRCN0000231926 CAACGCCAAACAATCAGTTTA pLKO_005 801 CDS 100% 13.200 18.480 N RASA1 n/a
3 TRCN0000220598 CCTGGCGATTATTCACTTTAT pLKO.1 740 CDS 100% 13.200 18.480 N RASA1 n/a
4 TRCN0000231925 TAATACTCCTGGCGATTATTC pLKO_005 733 CDS 100% 13.200 18.480 N RASA1 n/a
5 TRCN0000077656 CGGACACTACAGAGCATTCTA pLKO.1 2535 CDS 100% 5.625 7.875 N Rasa1 n/a
6 TRCN0000356447 CAGCTCCCATATACCATTAAA pLKO_005 1669 CDS 100% 15.000 12.000 N RASA1 n/a
7 TRCN0000231929 CATTTGACTGTTCAATGATTA pLKO_005 3205 3UTR 100% 13.200 10.560 N RASA1 n/a
8 TRCN0000356449 GCTGCAAGAACACTGATATTA pLKO_005 2369 CDS 100% 15.000 10.500 N RASA1 n/a
9 TRCN0000368862 GATGAAGCCACTACCCTATTT pLKO_005 1937 CDS 100% 13.200 9.240 N Rasa1 n/a
10 TRCN0000356448 GCAGGATATTTGCACTATTTC pLKO_005 2928 3UTR 100% 13.200 9.240 N RASA1 n/a
11 TRCN0000231927 GGTAGTGATGCCCAACTTATT pLKO_005 1088 CDS 100% 13.200 9.240 N RASA1 n/a
12 TRCN0000220600 CCTGACATCAATAGATTTGAA pLKO.1 1538 CDS 100% 5.625 3.938 N RASA1 n/a
13 TRCN0000220599 CCCTACATGGAAGGTGTCAAT pLKO.1 2444 CDS 100% 4.950 3.465 N RASA1 n/a
14 TRCN0000220596 GCTGCCTAACTTATCCATCTT pLKO.1 3619 3UTR 100% 4.950 3.465 N RASA1 n/a
15 TRCN0000077655 CCTCCTGACATCAATAGATTT pLKO.1 1535 CDS 100% 13.200 7.920 N Rasa1 n/a
16 TRCN0000220597 GCACACTAAATGACAGAGAAA pLKO.1 1905 CDS 100% 4.950 2.970 N RASA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022650.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01378 pDONR223 100% 82.9% 82.8% None 0_1ins531;2_3delTGinsCT;6_8delGGGinsCCA n/a
2 ccsbBroad304_01378 pLX_304 0% 82.9% 82.8% V5 0_1ins531;2_3delTGinsCT;6_8delGGGinsCCA n/a
3 TRCN0000479196 GTAGGCAGTTAGTCTAGGGTTCCT pLX_317 13.3% 82.9% 82.8% V5 0_1ins531;2_3delTGinsCT;6_8delGGGinsCCA n/a
Download CSV