Transcript: Human NM_022739.4

Homo sapiens SMAD specific E3 ubiquitin protein ligase 2 (SMURF2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SMURF2 (64750)
Length:
6240
CDS:
428..2674

Additional Resources:

NCBI RefSeq record:
NM_022739.4
NBCI Gene record:
SMURF2 (64750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022739.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284892 CACGACCGGCATCCGAATATT pLKO_005 993 CDS 100% 15.000 21.000 N SMURF2 n/a
2 TRCN0000003475 CGGTACAAGTCACATTTCATT pLKO.1 3070 3UTR 100% 5.625 7.875 N SMURF2 n/a
3 TRCN0000003478 CCACCCTATGAAAGCTATGAA pLKO.1 2594 CDS 100% 5.625 4.500 N SMURF2 n/a
4 TRCN0000027749 CCACACTTGCTTCAATCGAAT pLKO.1 2566 CDS 100% 4.950 3.960 N Smurf2 n/a
5 TRCN0000272879 ATTTACCCAGGACTCTATTTA pLKO_005 2687 3UTR 100% 15.000 10.500 N SMURF2 n/a
6 TRCN0000272881 GTGGACTGCAGTCGTTTATTT pLKO_005 872 CDS 100% 15.000 9.000 N SMURF2 n/a
7 TRCN0000003477 CGCCTCAAAGACACTGGTTAT pLKO.1 743 CDS 100% 10.800 6.480 N SMURF2 n/a
8 TRCN0000003476 GTGTGGATACTTGAGAATGAT pLKO.1 2027 CDS 100% 5.625 3.375 N SMURF2 n/a
9 TRCN0000010792 GCTGGATTTCTCGGTTGTGTT pLKO.1 698 CDS 100% 4.950 2.970 N SMURF2 n/a
10 TRCN0000272880 GCTGGATTTCTCGGTTGTGTT pLKO_005 698 CDS 100% 4.950 2.970 N SMURF2 n/a
11 TRCN0000272912 AGATCTCTGGAAGCGATTAAT pLKO_005 1675 CDS 100% 15.000 7.500 Y SMURF2 n/a
12 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5133 3UTR 100% 10.800 5.400 Y SMIM11A n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4968 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4968 3UTR 100% 4.950 2.475 Y C19orf31 n/a
15 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4966 3UTR 100% 4.950 2.475 Y ERN2 n/a
16 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4966 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4966 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022739.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03961 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03961 pLX_304 26.9% 100% 100% V5 n/a
Download CSV