Transcript: Human NM_022763.4

Homo sapiens fibronectin type III domain containing 3B (FNDC3B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
FNDC3B (64778)
Length:
8031
CDS:
223..3837

Additional Resources:

NCBI RefSeq record:
NM_022763.4
NBCI Gene record:
FNDC3B (64778)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022763.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229813 CGGTAGTGGTCCCGGAATTAA pLKO_005 936 CDS 100% 15.000 21.000 N FNDC3B n/a
2 TRCN0000082777 GCCATCATTGTGCTTGGCTTT pLKO.1 3763 CDS 100% 4.050 5.670 N FNDC3B n/a
3 TRCN0000082773 CCCTAATTGAATGTGTTTGAA pLKO.1 6768 3UTR 100% 5.625 4.500 N FNDC3B n/a
4 TRCN0000082776 GCAGCCCAAAGTCGAATGATT pLKO.1 980 CDS 100% 5.625 4.500 N FNDC3B n/a
5 TRCN0000082774 CGGATCTGAAATCCTTGCTTA pLKO.1 2910 CDS 100% 4.950 3.960 N FNDC3B n/a
6 TRCN0000082775 CGTGCAATAACGGATCTGAAA pLKO.1 2900 CDS 100% 4.950 3.960 N FNDC3B n/a
7 TRCN0000229811 ATGCAGCTCAGCAGGTTATTC pLKO_005 320 CDS 100% 13.200 9.240 N FNDC3B n/a
8 TRCN0000229812 CATGTGCCTCCAGGTTATATC pLKO_005 460 CDS 100% 13.200 9.240 N FNDC3B n/a
9 TRCN0000229814 GGACAGAAACAAGAGGTTTAT pLKO_005 3216 CDS 100% 13.200 9.240 N FNDC3B n/a
10 TRCN0000218262 GTGTTACTCTTACGTGTTTAT pLKO_005 5194 3UTR 100% 13.200 9.240 N FNDC3B n/a
11 TRCN0000382174 TGCCATGTACAATTCCGTAAA pLKO_005 1290 CDS 100% 10.800 7.560 N FNDC3B n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7537 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 7409 3UTR 100% 2.640 1.320 Y LINC01098 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7537 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022763.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12489 pDONR223 100% 5.2% 4.9% None (many diffs) n/a
2 ccsbBroad304_12489 pLX_304 0% 5.2% 4.9% V5 (many diffs) n/a
3 TRCN0000473998 CTTAAATCGATCTACCCCACAGTC pLX_317 100% 5.2% 4.9% V5 (many diffs) n/a
Download CSV