Transcript: Human NM_022776.5

Homo sapiens oxysterol binding protein like 11 (OSBPL11), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
OSBPL11 (114885)
Length:
4598
CDS:
698..2941

Additional Resources:

NCBI RefSeq record:
NM_022776.5
NBCI Gene record:
OSBPL11 (114885)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022776.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162514 CATGTCAATAGGCGTGACAAT pLKO.1 2320 CDS 100% 0.495 0.396 N OSBPL11 n/a
2 TRCN0000105197 GCAACTATGAACTGCTTAAAT pLKO.1 1484 CDS 100% 15.000 10.500 N Osbpl11 n/a
3 TRCN0000325814 GCAACTATGAACTGCTTAAAT pLKO_005 1484 CDS 100% 15.000 10.500 N Osbpl11 n/a
4 TRCN0000158527 CACTTGCATCTAGTAGTAATT pLKO.1 1218 CDS 100% 13.200 9.240 N OSBPL11 n/a
5 TRCN0000161455 CGAGTGGTTAGAACCAAAGAT pLKO.1 1576 CDS 100% 5.625 3.938 N OSBPL11 n/a
6 TRCN0000160386 CAGGATCTCTTAATGCTCAAA pLKO.1 1451 CDS 100% 4.950 3.465 N OSBPL11 n/a
7 TRCN0000160605 CTGTTGGAGTACTTTGTGAAT pLKO.1 959 CDS 100% 4.950 3.465 N OSBPL11 n/a
8 TRCN0000158810 CTTGAGTTCACATATAGCAAT pLKO.1 2612 CDS 100% 4.950 3.465 N OSBPL11 n/a
9 TRCN0000161317 GCTGTAATATCACCCAGTGAT pLKO.1 1028 CDS 100% 4.950 3.465 N OSBPL11 n/a
10 TRCN0000161454 CCAGGATCTCTTAATGCTCAA pLKO.1 1450 CDS 100% 4.050 2.835 N OSBPL11 n/a
11 TRCN0000343356 CCAGGATCTCTTAATGCTCAA pLKO_005 1450 CDS 100% 4.050 2.835 N OSBPL11 n/a
12 TRCN0000160239 CCTACTTATTATGGTGCTCAA pLKO.1 4192 3UTR 100% 4.050 2.430 N OSBPL11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022776.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13042 pDONR223 100% 49.1% 49.1% None 1_1140del n/a
2 ccsbBroad304_13042 pLX_304 0% 49.1% 49.1% V5 1_1140del n/a
3 TRCN0000480767 GCTGGCAATCCTATTCCCTAGAAC pLX_317 47.9% 49.1% 49.1% V5 1_1140del n/a
Download CSV