Transcript: Mouse NM_022889.3

Mus musculus pescadillo ribosomal biogenesis factor 1 (Pes1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Pes1 (64934)
Length:
2911
CDS:
63..1817

Additional Resources:

NCBI RefSeq record:
NM_022889.3
NBCI Gene record:
Pes1 (64934)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102591 CCGTAGGCTCACTGTGGAGTT pLKO.1 545 CDS 100% 1.350 1.890 N Pes1 n/a
2 TRCN0000324646 CCGTAGGCTCACTGTGGAGTT pLKO_005 545 CDS 100% 1.350 1.890 N Pes1 n/a
3 TRCN0000102594 CGAGAGTACAAGGTGTTTGTT pLKO.1 309 CDS 100% 5.625 4.500 N Pes1 n/a
4 TRCN0000353861 CGAGAGTACAAGGTGTTTGTT pLKO_005 309 CDS 100% 5.625 4.500 N Pes1 n/a
5 TRCN0000102592 GATGACAACGAAGGTGATGTT pLKO.1 1449 CDS 100% 4.950 3.465 N Pes1 n/a
6 TRCN0000102593 GATGATGACAACGAAGGTGAT pLKO.1 1446 CDS 100% 4.050 2.835 N Pes1 n/a
7 TRCN0000353932 GATGATGACAACGAAGGTGAT pLKO_005 1446 CDS 100% 4.050 2.835 N Pes1 n/a
8 TRCN0000102590 GCTCACACTTCCACATTGTAT pLKO.1 2521 3UTR 100% 5.625 3.375 N Pes1 n/a
9 TRCN0000324647 GCTCACACTTCCACATTGTAT pLKO_005 2521 3UTR 100% 5.625 3.375 N Pes1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02777 pDONR223 100% 84.9% 89.1% None (many diffs) n/a
2 ccsbBroad304_02777 pLX_304 0% 84.9% 89.1% V5 (many diffs) n/a
3 TRCN0000474494 GCTGCTAACCAGGACTGGCGTCTT pLX_317 23.2% 84.9% 89.1% V5 (many diffs) n/a
Download CSV