Transcript: Human NM_022902.5

Homo sapiens solute carrier family 30 member 5 (SLC30A5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SLC30A5 (64924)
Length:
3992
CDS:
243..2540

Additional Resources:

NCBI RefSeq record:
NM_022902.5
NBCI Gene record:
SLC30A5 (64924)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022902.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304224 ACGTACCCAGCGCTCGATTAA pLKO_005 310 CDS 100% 13.200 18.480 N SLC30A5 n/a
2 TRCN0000042826 CGAATCATATGATCTCCTAAA pLKO.1 386 CDS 100% 0.000 0.000 N SLC30A5 n/a
3 TRCN0000300935 CGAATCATATGATCTCCTAAA pLKO_005 386 CDS 100% 0.000 0.000 N SLC30A5 n/a
4 TRCN0000042825 GTTCACATTGTTCAGTTCATT pLKO.1 411 CDS 100% 5.625 3.938 N SLC30A5 n/a
5 TRCN0000300936 GTTCACATTGTTCAGTTCATT pLKO_005 411 CDS 100% 5.625 3.938 N SLC30A5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022902.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03984 pDONR223 100% 13.2% 12.3% None (many diffs) n/a
2 ccsbBroad304_03984 pLX_304 0% 13.2% 12.3% V5 (many diffs) n/a
3 TRCN0000481364 CACACGAACGTTTACTGCCGCCAT pLX_317 100% 13.2% 12.3% V5 (many diffs) n/a
Download CSV