Transcript: Human NM_022968.2

Homo sapiens small EDRK-rich factor 1A (SERF1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SERF1A (8293)
Length:
699
CDS:
202..390

Additional Resources:

NCBI RefSeq record:
NM_022968.2
NBCI Gene record:
SERF1A (8293)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022968.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127537 CCAGGAAATTAGCAAGGGAAA pLKO.1 255 CDS 100% 4.050 2.025 Y SERF1B n/a
2 TRCN0000127987 GAAAGAGGAAAGAGGATAGCT pLKO.1 272 CDS 100% 3.000 1.500 Y SERF1B n/a
3 TRCN0000137176 GAAAGAGGAAAGAGGATAGCT pLKO.1 272 CDS 100% 3.000 1.500 Y SERF1A n/a
4 TRCN0000181437 CTCAGAGAAAGCAGAGGGATT pLKO.1 302 CDS 100% 4.050 2.025 Y Serf1 n/a
5 TRCN0000340648 CTCAGAGAAAGCAGAGGGATT pLKO_005 302 CDS 100% 4.050 2.025 Y Serf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022968.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01882 pDONR223 100% 45.2% 38.1% None (many diffs) n/a
2 ccsbBroad304_01882 pLX_304 0% 45.2% 38.1% V5 (many diffs) n/a
3 TRCN0000470443 TCAACTGCCCGGGCTAAAATCAGC pLX_317 100% 45.2% 38.1% V5 (many diffs) n/a
Download CSV