Transcript: Mouse NM_022982.2

Mus musculus reticulon 4 receptor (Rtn4r), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rtn4r (65079)
Length:
1890
CDS:
176..1597

Additional Resources:

NCBI RefSeq record:
NM_022982.2
NBCI Gene record:
Rtn4r (65079)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022982.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071718 CCACCAGGTGTGTGTACATAT pLKO.1 1609 3UTR 100% 13.200 9.240 N Rtn4r n/a
2 TRCN0000442198 AGCTTCCAGTCATGCCGAAAT pLKO_005 401 CDS 100% 10.800 7.560 N Rtn4r n/a
3 TRCN0000436683 AGCCTCTAGCCAGCGAATCTT pLKO_005 343 CDS 100% 5.625 3.938 N Rtn4r n/a
4 TRCN0000071721 CTCTACCTACAAGACAACAAT pLKO.1 650 CDS 100% 5.625 3.938 N Rtn4r n/a
5 TRCN0000071720 CCTCTACCTGTTTGCCAACAA pLKO.1 865 CDS 100% 4.950 3.465 N Rtn4r n/a
6 TRCN0000071719 GCACATCAATGACTCTCCATT pLKO.1 1306 CDS 100% 4.950 3.465 N Rtn4r n/a
7 TRCN0000071722 GCTACAATGAGCCCAAGGTAA pLKO.1 273 CDS 100% 4.950 2.970 N Rtn4r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022982.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03995 pDONR223 100% 83.1% 89.4% None (many diffs) n/a
2 ccsbBroad304_03995 pLX_304 0% 83.1% 89.4% V5 (many diffs) n/a
3 TRCN0000470625 ATCGGGCATCATCTCAAAGATCCC pLX_317 31.9% 83.1% 89.4% V5 (many diffs) n/a
Download CSV