Transcript: Mouse NM_023047.2

Mus musculus dihydropyrimidinase-like 5 (Dpysl5), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Dpysl5 (65254)
Length:
5077
CDS:
280..1974

Additional Resources:

NCBI RefSeq record:
NM_023047.2
NBCI Gene record:
Dpysl5 (65254)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032730 CCCAGACATTGTCTATAAGAA pLKO.1 1680 CDS 100% 5.625 3.938 N Dpysl5 n/a
2 TRCN0000032732 CCTGGTCAATGTGTCTAGTAT pLKO.1 1011 CDS 100% 5.625 3.938 N Dpysl5 n/a
3 TRCN0000032731 CTGAACATTGTGGCATCCGAT pLKO.1 1234 CDS 100% 2.640 1.848 N Dpysl5 n/a
4 TRCN0000032733 GATTCTCATCAAGGGAGGCAA pLKO.1 306 CDS 100% 2.640 1.848 N Dpysl5 n/a
5 TRCN0000032729 CCAGATGTTCATGACCTACAA pLKO.1 750 CDS 100% 4.950 2.970 N Dpysl5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08655 pDONR223 100% 90.3% 97.8% None (many diffs) n/a
2 ccsbBroad304_08655 pLX_304 0% 90.3% 97.8% V5 (many diffs) n/a
3 TRCN0000473577 TTACCCTCATTTCCATAGGCGGGG pLX_317 27.3% 90.3% 97.8% V5 (many diffs) n/a
Download CSV