Transcript: Mouse NM_023049.1

Mus musculus ankyrin repeat and SOCS box-containing 2 (Asb2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Asb2 (65256)
Length:
2707
CDS:
390..2294

Additional Resources:

NCBI RefSeq record:
NM_023049.1
NBCI Gene record:
Asb2 (65256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023049.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084621 CGATGCTAACAAAGCCAACAA pLKO.1 1373 CDS 100% 4.950 6.930 N Asb2 n/a
2 TRCN0000420789 AGCCTGACATCTCTAACAAAT pLKO_005 979 CDS 100% 13.200 9.240 N Asb2 n/a
3 TRCN0000084619 GCTAATCAGATACCTGAAATA pLKO.1 2258 CDS 100% 13.200 9.240 N Asb2 n/a
4 TRCN0000433666 ACATGAGGAATACAGCCTATA pLKO_005 434 CDS 100% 10.800 7.560 N Asb2 n/a
5 TRCN0000435804 GTCGTTACTCAAGTTCCTTAT pLKO_005 1856 CDS 100% 10.800 7.560 N Asb2 n/a
6 TRCN0000420247 TCTACGAGGCCAGCAAGAATG pLKO_005 1312 CDS 100% 10.800 7.560 N Asb2 n/a
7 TRCN0000084620 GCCTCCAAGAAGGGCAACTAT pLKO.1 1419 CDS 100% 5.625 3.938 N Asb2 n/a
8 TRCN0000084622 CAGGCTAATCAGATACCTGAA pLKO.1 2255 CDS 100% 4.050 2.835 N Asb2 n/a
9 TRCN0000084618 GCTGGTTCTTTGCTGGAGCTT pLKO.1 2391 3UTR 100% 2.640 1.848 N Asb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023049.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03364 pDONR223 100% 79.8% 81.1% None (many diffs) n/a
2 ccsbBroad304_03364 pLX_304 0% 79.8% 81.1% V5 (many diffs) n/a
3 TRCN0000471946 CCCCGAAGCGACCCATCTTTTGAC pLX_317 22.6% 79.8% 81.1% V5 (many diffs) n/a
Download CSV