Transcript: Mouse NM_023119.2

Mus musculus enolase 1, alpha non-neuron (Eno1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Eno1 (13806)
Length:
1831
CDS:
154..1458

Additional Resources:

NCBI RefSeq record:
NM_023119.2
NBCI Gene record:
Eno1 (13806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023119.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114448 GCTGTTGAGCACATCAATAAA pLKO.1 346 CDS 100% 15.000 7.500 Y Eno1b n/a
2 TRCN0000284627 GGCACAGAGAATAAATCTAAA pLKO_005 448 CDS 100% 13.200 6.600 Y Gm4735 n/a
3 TRCN0000284624 GGCTGTTGAGCACATCAATAA pLKO_005 345 CDS 100% 13.200 6.600 Y Gm4735 n/a
4 TRCN0000272008 CCCTAGAACTCCGAGACAATG pLKO_005 290 CDS 100% 10.800 5.400 Y Gm4735 n/a
5 TRCN0000272010 CGCATTGGAGCAGAGGTTTAC pLKO_005 700 CDS 100% 10.800 5.400 Y Gm4735 n/a
6 TRCN0000272006 CCCATGTCACTGCTTCCTTAG pLKO_005 1553 3UTR 100% 6.000 3.000 Y Gm4735 n/a
7 TRCN0000114414 CCTAACATCCTGGAGAACAAA pLKO.1 796 CDS 100% 5.625 2.813 Y Eno1 n/a
8 TRCN0000114450 CCTGCTCTGGTTAGCAAGAAA pLKO.1 376 CDS 100% 5.625 2.813 Y Eno1b n/a
9 TRCN0000114412 CGGCACAGAGAATAAATCTAA pLKO.1 447 CDS 100% 5.625 2.813 Y Eno1 n/a
10 TRCN0000114446 GATTGGTCTGAATCATTGTTT pLKO.1 1629 3UTR 100% 5.625 2.813 Y Eno1b n/a
11 TRCN0000114413 CCCGGCTTTCAATGTGATCAA pLKO.1 594 CDS 100% 4.950 2.475 Y Eno1 n/a
12 TRCN0000114415 CTGGTTAGCAAGAAAGTGAAT pLKO.1 382 CDS 100% 4.950 2.475 Y Eno1 n/a
13 TRCN0000114411 CAATCATGTGATTGGTCTGAA pLKO.1 1620 3UTR 100% 0.495 0.248 Y Eno1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023119.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06160 pDONR223 100% 88% 94.4% None (many diffs) n/a
2 ccsbBroad304_06160 pLX_304 0% 88% 94.4% V5 (many diffs) n/a
3 TRCN0000473656 GCTCTCATAGGGCATGCCCCCTCG pLX_317 41.9% 88% 94.4% V5 (many diffs) n/a
Download CSV