Transcript: Mouse NM_023131.1

Mus musculus Ras converting CAAX endopeptidase 1 (Rce1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rce1 (19671)
Length:
1446
CDS:
1..990

Additional Resources:

NCBI RefSeq record:
NM_023131.1
NBCI Gene record:
Rce1 (19671)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031470 GCTGGCTACGAAACCAAGTTA pLKO.1 488 CDS 100% 5.625 7.875 N Rce1 n/a
2 TRCN0000354233 GCTGGCTACGAAACCAAGTTA pLKO_005 488 CDS 100% 5.625 7.875 N Rce1 n/a
3 TRCN0000031469 CCACTCTTTCTGCAACTACAT pLKO.1 780 CDS 100% 4.950 3.465 N Rce1 n/a
4 TRCN0000354157 CCACTCTTTCTGCAACTACAT pLKO_005 780 CDS 100% 4.950 3.465 N Rce1 n/a
5 TRCN0000031471 TGCTGCTAACTATGATCCTTT pLKO.1 359 CDS 100% 4.950 3.465 N Rce1 n/a
6 TRCN0000332567 TGCTGCTAACTATGATCCTTT pLKO_005 359 CDS 100% 4.950 3.465 N Rce1 n/a
7 TRCN0000031472 CCCAAGCTCTATGGCAGCCTT pLKO.1 913 CDS 100% 0.880 0.616 N Rce1 n/a
8 TRCN0000332566 CCCAAGCTCTATGGCAGCCTT pLKO_005 913 CDS 100% 0.880 0.616 N Rce1 n/a
9 TRCN0000031473 CCGCTGTTATCAAGCGGCGTT pLKO.1 194 CDS 100% 0.072 0.050 N Rce1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02281 pDONR223 100% 89.4% 94.8% None (many diffs) n/a
2 ccsbBroad304_02281 pLX_304 0% 89.4% 94.8% V5 (many diffs) n/a
3 TRCN0000481295 ACTGGATCCCGTTGTCAACCAGGA pLX_317 49.3% 89.4% 94.8% V5 (many diffs) n/a
Download CSV