Transcript: Mouse NM_023196.4

Mus musculus phospholipase A2, group XIIA (Pla2g12a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pla2g12a (66350)
Length:
1561
CDS:
114..692

Additional Resources:

NCBI RefSeq record:
NM_023196.4
NBCI Gene record:
Pla2g12a (66350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023196.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098777 GCTGGTGTCGTTATGAAGAAA pLKO.1 658 CDS 100% 5.625 7.875 N Pla2g12a n/a
2 TRCN0000098776 GCGTTCATCTGAACATAGGTA pLKO.1 400 CDS 100% 3.000 4.200 N Pla2g12a n/a
3 TRCN0000098775 GCCCACTAAGATAGGTATAAA pLKO.1 1186 3UTR 100% 15.000 10.500 N Pla2g12a n/a
4 TRCN0000098778 CAAGATAGACACGTACCTCAA pLKO.1 251 CDS 100% 4.050 2.835 N Pla2g12a n/a
5 TRCN0000098779 CCACAAGATAGACACGTACCT pLKO.1 248 CDS 100% 2.640 1.848 N Pla2g12a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023196.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04243 pDONR223 100% 81.8% 88% None (many diffs) n/a
2 ccsbBroad304_04243 pLX_304 0% 81.8% 88% V5 (many diffs) n/a
3 TRCN0000473748 GCAGTAAATTGTCACTGTTAACAA pLX_317 67.1% 81.8% 88% V5 (many diffs) n/a
Download CSV