Transcript: Mouse NM_023434.3

Mus musculus TOX high mobility group box family member 4 (Tox4), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tox4 (268741)
Length:
4458
CDS:
351..2210

Additional Resources:

NCBI RefSeq record:
NM_023434.3
NBCI Gene record:
Tox4 (268741)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023434.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235927 AGCCAGTTGACCACTATTGAT pLKO_005 765 CDS 100% 5.625 7.875 N Tox4 n/a
2 TRCN0000084521 GCTTATAAAGACAACCAGGAA pLKO.1 1215 CDS 100% 2.640 3.696 N Tox4 n/a
3 TRCN0000235924 CTAAGTGGAAAGCCATAATTT pLKO_005 3772 3UTR 100% 15.000 10.500 N Tox4 n/a
4 TRCN0000379072 CTGGAGGTCAGCCCAATATTA pLKO_005 1426 CDS 100% 15.000 10.500 N Tox4 n/a
5 TRCN0000374290 AGACATGACATCTGGCTTAAT pLKO_005 737 CDS 100% 13.200 9.240 N Tox4 n/a
6 TRCN0000374355 ATGGACCTGGACCATTCTATA pLKO_005 666 CDS 100% 13.200 9.240 N Tox4 n/a
7 TRCN0000084518 GCCAGCAAATTCACTGTAATT pLKO.1 2546 3UTR 100% 13.200 9.240 N Tox4 n/a
8 TRCN0000374289 TAGAAGAAACATACCAGTAAA pLKO_005 2658 3UTR 100% 13.200 9.240 N Tox4 n/a
9 TRCN0000235926 CCCAACTCAACAGCAAGTAAC pLKO_005 1706 CDS 100% 10.800 7.560 N Tox4 n/a
10 TRCN0000374292 CTACTCCTTCACCTACCAATT pLKO_005 874 CDS 100% 10.800 7.560 N Tox4 n/a
11 TRCN0000141114 CCTTCTCAGATGGATGTTGAA pLKO.1 1995 CDS 100% 4.950 3.465 N TOX4 n/a
12 TRCN0000336842 CCTTCTCAGATGGATGTTGAA pLKO_005 1995 CDS 100% 4.950 3.465 N TOX4 n/a
13 TRCN0000235923 GAAATGATCGCAGATGTAGTT pLKO_005 1959 CDS 100% 4.950 3.465 N Tox4 n/a
14 TRCN0000084519 CCGAGACATTCCATACACCAA pLKO.1 421 CDS 100% 2.640 1.848 N Tox4 n/a
15 TRCN0000140848 CCGAGACATTCCATACACCAA pLKO.1 421 CDS 100% 2.640 1.848 N TOX4 n/a
16 TRCN0000336898 CCGAGACATTCCATACACCAA pLKO_005 421 CDS 100% 2.640 1.848 N TOX4 n/a
17 TRCN0000084522 GTTCTCAACTTGGTTTGAGTT pLKO.1 799 CDS 100% 0.495 0.347 N Tox4 n/a
18 TRCN0000084520 GCTACTGTGGAAACAGTGGAA pLKO.1 1242 CDS 100% 0.264 0.185 N Tox4 n/a
19 TRCN0000235925 TCTGTGGTGTTTGTGAAGTAG pLKO_005 2190 CDS 100% 4.950 2.970 N Tox4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023434.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07501 pDONR223 100% 89.5% 95% None (many diffs) n/a
2 ccsbBroad304_07501 pLX_304 0% 89.5% 95% V5 (many diffs) n/a
3 TRCN0000468555 CTAAAAGCTTGAGACCCAGTTATG pLX_317 21.8% 89.5% 95% V5 (many diffs) n/a
Download CSV