Transcript: Mouse NM_023502.2

Mus musculus E74-like factor 2 (Elf2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Elf2 (69257)
Length:
5900
CDS:
478..2259

Additional Resources:

NCBI RefSeq record:
NM_023502.2
NBCI Gene record:
Elf2 (69257)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311036 CTATGACGACGAGACTTATAT pLKO_005 642 CDS 100% 15.000 21.000 N Elf2 n/a
2 TRCN0000304564 GCACAGGCTCGCCGTTAATAA pLKO_005 1724 CDS 100% 15.000 12.000 N Elf2 n/a
3 TRCN0000085992 GCATAAGAACAAACCAGATAT pLKO.1 1233 CDS 100% 13.200 10.560 N Elf2 n/a
4 TRCN0000304563 AGTTATCAGTGCGCTCCTAAA pLKO_005 2055 CDS 100% 10.800 8.640 N Elf2 n/a
5 TRCN0000085990 GCCCTTCCTGTGACTATGAAA pLKO.1 2209 CDS 100% 5.625 3.938 N Elf2 n/a
6 TRCN0000085989 GCGAGCGTTAAGATATTACTA pLKO.1 1272 CDS 100% 5.625 3.938 N Elf2 n/a
7 TRCN0000085991 GCTGATGACAAGTCTTTAGAA pLKO.1 1420 CDS 100% 5.625 3.938 N Elf2 n/a
8 TRCN0000085988 CGTCATTGTTACAAAGAGCAT pLKO.1 2607 3UTR 100% 2.640 1.848 N Elf2 n/a
9 TRCN0000302002 CGTCATTGTTACAAAGAGCAT pLKO_005 2607 3UTR 100% 2.640 1.848 N Elf2 n/a
10 TRCN0000273913 ATACTTGTCCCAGGTATATTA pLKO_005 1142 CDS 100% 15.000 9.000 N ELF2 n/a
11 TRCN0000304586 ATACTTGTCCCAGGTATATTA pLKO_005 1142 CDS 100% 15.000 9.000 N Elf2 n/a
12 TRCN0000013861 GTACACCTGTAATGAGACTAT pLKO.1 1994 CDS 100% 4.950 6.930 N ELF2 n/a
13 TRCN0000013860 CGTAAACCAAAGACCCAGCAA pLKO.1 1009 CDS 100% 2.640 1.848 N ELF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06156 pDONR223 100% 78.3% 79.5% None (many diffs) n/a
2 ccsbBroad304_06156 pLX_304 0% 78.3% 79.5% V5 (many diffs) n/a
3 TRCN0000471766 CGTTACGCACTCAAGTCTTTGTGC pLX_317 29.2% 78.3% 79.5% V5 (many diffs) n/a
4 ccsbBroadEn_10799 pDONR223 100% 67% 67.1% None (many diffs) n/a
5 ccsbBroad304_10799 pLX_304 0% 67% 67.1% V5 (many diffs) n/a
6 TRCN0000469930 CCCTGCAGCAGATTCATTATTAGA pLX_317 32.1% 67% 67.1% V5 (many diffs) n/a
Download CSV