Transcript: Mouse NM_023536.3

Mus musculus mRNA turnover 4, ribosome maturation factor (Mrto4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Mrto4 (69902)
Length:
1239
CDS:
281..997

Additional Resources:

NCBI RefSeq record:
NM_023536.3
NBCI Gene record:
Mrto4 (69902)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023536.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072700 AGCCGGATGTTCTTTGGCAAA pLKO.1 467 CDS 100% 4.050 5.670 N MRTO4 n/a
2 TRCN0000104356 CCTGCTGTTTGGGTATGAGAT pLKO.1 847 CDS 100% 4.950 3.960 N Mrto4 n/a
3 TRCN0000313421 TCGAAGCCCATCTGATGAATA pLKO_005 514 CDS 100% 13.200 9.240 N Mrto4 n/a
4 TRCN0000313420 TGAGTGGTTCACCAAGTATAC pLKO_005 619 CDS 100% 10.800 7.560 N Mrto4 n/a
5 TRCN0000104355 TCCAGCGAGTTCTTCATCTTT pLKO.1 1022 3UTR 100% 5.625 3.938 N Mrto4 n/a
6 TRCN0000349444 TCCAGCGAGTTCTTCATCTTT pLKO_005 1022 3UTR 100% 5.625 3.938 N Mrto4 n/a
7 TRCN0000313419 ATCCTGCTGTTTGGGTATGAG pLKO_005 845 CDS 100% 4.950 3.465 N Mrto4 n/a
8 TRCN0000104357 CCAAGTATACAGAAATGGATT pLKO.1 630 CDS 100% 4.950 3.465 N Mrto4 n/a
9 TRCN0000104359 CCTGATAGAAGAGCTTCGGAA pLKO.1 355 CDS 100% 2.640 1.848 N Mrto4 n/a
10 TRCN0000349387 CCTGATAGAAGAGCTTCGGAA pLKO_005 355 CDS 100% 2.640 1.848 N Mrto4 n/a
11 TRCN0000104358 CAGGCCCGTATCCTGCTGTTT pLKO.1 836 CDS 100% 1.650 1.155 N Mrto4 n/a
12 TRCN0000072702 TGGGTATGAGATGGCTGAATT pLKO.1 856 CDS 100% 0.000 0.000 N MRTO4 n/a
13 TRCN0000298246 TGGGTATGAGATGGCTGAATT pLKO_005 856 CDS 100% 0.000 0.000 N MRTO4 n/a
14 TRCN0000072699 CTGCCAAGAAAGGCTTGGAAT pLKO.1 324 CDS 100% 0.495 0.347 N MRTO4 n/a
15 TRCN0000286645 CTGCCAAGAAAGGCTTGGAAT pLKO_005 324 CDS 100% 0.495 0.347 N MRTO4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023536.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08234 pDONR223 100% 88.4% 92.8% None (many diffs) n/a
2 ccsbBroad304_08234 pLX_304 0% 88.4% 92.8% V5 (many diffs) n/a
3 TRCN0000466401 TCATGCTGCGCCGTGGGACTGTGA pLX_317 30.2% 88.4% 92.8% V5 (many diffs) n/a
Download CSV