Transcript: Mouse NM_023709.4

Mus musculus calpain 9 (Capn9), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Capn9 (73647)
Length:
2346
CDS:
35..2107

Additional Resources:

NCBI RefSeq record:
NM_023709.4
NBCI Gene record:
Capn9 (73647)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023709.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030680 GCCAAGCTTAACGGGAGTTAT pLKO.1 566 CDS 100% 13.200 18.480 N Capn9 n/a
2 TRCN0000030679 CCGAAGCAAGACGTTCATCAA pLKO.1 1366 CDS 100% 4.950 6.930 N Capn9 n/a
3 TRCN0000030682 CGAACATCTCTTGGTCTCATT pLKO.1 767 CDS 100% 4.950 3.960 N Capn9 n/a
4 TRCN0000030683 CCTGAGAATCTTCTCTGAGAA pLKO.1 1480 CDS 100% 4.950 3.465 N Capn9 n/a
5 TRCN0000030681 CCATCTCAACATAAACGAGTT pLKO.1 2062 CDS 100% 4.050 2.835 N Capn9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023709.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11545 pDONR223 100% 75.5% 77.3% None (many diffs) n/a
2 ccsbBroad304_11545 pLX_304 0% 75.5% 77.3% V5 (many diffs) n/a
3 TRCN0000479280 AAACCTGTAGTTTTCCCTACCCAA pLX_317 19.3% 75.5% 77.3% V5 (many diffs) n/a
Download CSV