Transcript: Mouse NM_023764.3

Mus musculus toll interacting protein (Tollip), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tollip (54473)
Length:
3705
CDS:
99..923

Additional Resources:

NCBI RefSeq record:
NM_023764.3
NBCI Gene record:
Tollip (54473)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066135 CCTCGCTGGAACAAAGTCATT pLKO.1 390 CDS 100% 4.950 3.465 N Tollip n/a
2 TRCN0000302407 CCTCGCTGGAACAAAGTCATT pLKO_005 390 CDS 100% 4.950 3.465 N Tollip n/a
3 TRCN0000066136 CTCCGTATAACACCCACACAA pLKO.1 162 CDS 100% 4.950 3.465 N Tollip n/a
4 TRCN0000066137 CATGACTCGTATGGACCCTTA pLKO.1 305 CDS 100% 4.050 2.835 N Tollip n/a
5 TRCN0000302405 CATGACTCGTATGGACCCTTA pLKO_005 305 CDS 100% 4.050 2.835 N Tollip n/a
6 TRCN0000066134 CCTCAAAGCTATCCAGGACAT pLKO.1 797 CDS 100% 4.050 2.835 N Tollip n/a
7 TRCN0000302406 CCTCAAAGCTATCCAGGACAT pLKO_005 797 CDS 100% 4.050 2.835 N Tollip n/a
8 TRCN0000066133 GCCATCAATTCCTTGCTGCAA pLKO.1 885 CDS 100% 2.640 1.584 N Tollip n/a
9 TRCN0000302335 GCCATCAATTCCTTGCTGCAA pLKO_005 885 CDS 100% 2.640 1.584 N Tollip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03420 pDONR223 100% 86% 92.7% None (many diffs) n/a
2 ccsbBroad304_03420 pLX_304 0% 86% 92.7% V5 (many diffs) n/a
3 TRCN0000466589 GATTTGCACCTTAGACAGGGGGTC pLX_317 28.7% 86% 92.7% V5 (many diffs) n/a
4 ccsbBroadEn_08382 pDONR223 100% 86% 92.7% None (many diffs) n/a
5 ccsbBroad304_08382 pLX_304 0% 86% 92.7% V5 (many diffs) n/a
6 TRCN0000479669 GATAAACAAGTCATTGATCTGGAA pLX_317 38% 86% 92.7% V5 (many diffs) n/a
Download CSV