Transcript: Mouse NM_023794.2

Mus musculus ets variant 5 (Etv5), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Etv5 (104156)
Length:
3847
CDS:
133..1665

Additional Resources:

NCBI RefSeq record:
NM_023794.2
NBCI Gene record:
Etv5 (104156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023794.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349768 TACATGAGAGGCGGGTATTTC pLKO_005 1066 CDS 100% 13.200 18.480 N Etv5 n/a
2 TRCN0000312868 CCGAAGGCTTCGCTTACTAAG pLKO_005 1646 CDS 100% 10.800 15.120 N Etv5 n/a
3 TRCN0000054784 ACAACTATTGTGCCTACGATA pLKO.1 485 CDS 100% 4.950 6.930 N Etv5 n/a
4 TRCN0000311818 ACAACTATTGTGCCTACGATA pLKO_005 485 CDS 100% 4.950 6.930 N Etv5 n/a
5 TRCN0000054783 GCGACCTTTGATTGACAGAAA pLKO.1 204 CDS 100% 4.950 6.930 N Etv5 n/a
6 TRCN0000054785 CAGTCTGATAACTTGGTGCTT pLKO.1 352 CDS 100% 2.640 2.112 N Etv5 n/a
7 TRCN0000312867 AGCTTGCCCTTTGAGTATTAT pLKO_005 1762 3UTR 100% 15.000 10.500 N Etv5 n/a
8 TRCN0000312912 CACCTCCCACCAAGATCAAAC pLKO_005 380 CDS 100% 10.800 7.560 N Etv5 n/a
9 TRCN0000054786 AGGAAGTTTGTGGACACAGAT pLKO.1 226 CDS 100% 4.950 3.465 N Etv5 n/a
10 TRCN0000054787 GCCAGCCATGAACTATGACAA pLKO.1 1374 CDS 100% 4.950 2.970 N Etv5 n/a
11 TRCN0000013940 CTCTACAACTATTGTGCCTAT pLKO.1 481 CDS 100% 4.050 2.835 N ETV5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023794.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00521 pDONR223 100% 90% 95.4% None (many diffs) n/a
2 ccsbBroad304_00521 pLX_304 0% 90% 95.4% V5 (many diffs) n/a
3 TRCN0000467138 TTCGAGCCTGTGGTCAGAATCACT pLX_317 26.9% 90% 95.4% V5 (many diffs) n/a
Download CSV