Transcript: Mouse NM_023835.2

Mus musculus tripartite motif-containing 12A (Trim12a), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Trim12a (76681)
Length:
1553
CDS:
142..1035

Additional Resources:

NCBI RefSeq record:
NM_023835.2
NBCI Gene record:
Trim12a (76681)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023835.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041163 GCCGAATTAGTTACCAGTTTA pLKO.1 314 CDS 100% 13.200 9.240 N Trim12a n/a
2 TRCN0000041164 GCGATAAGAAAGTGTTCATTT pLKO.1 284 CDS 100% 13.200 9.240 N Trim12a n/a
3 TRCN0000238214 TCCCTCCGCCATGGACAAATT pLKO_005 1045 3UTR 100% 13.200 9.240 N Trim12a n/a
4 TRCN0000238215 GCTAAGGGCTGTCACTTACAT pLKO_005 1382 3UTR 100% 5.625 3.938 N Trim12a n/a
5 TRCN0000238218 ACTCCAAACCAGCAGATACAG pLKO_005 1225 3UTR 100% 4.950 3.465 N Trim12a n/a
6 TRCN0000238216 ACTCTAGGCCACCAATAGATG pLKO_005 1285 3UTR 100% 4.950 3.465 N Trim12a n/a
7 TRCN0000238217 ACAGAGGCTCATCGCTACTAG pLKO_005 1015 CDS 100% 4.950 2.970 N Trim12a n/a
8 TRCN0000041166 GCTCTTCTGTAGGAAGGACAT pLKO.1 453 CDS 100% 4.050 2.025 Y Trim12a n/a
9 TRCN0000041167 GCAGAGTCTGAAAGTGAGCAT pLKO.1 787 CDS 100% 2.640 1.320 Y Trim12a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023835.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.