Transcript: Mouse NM_023906.3

Mus musculus ankyrin repeat and SOCS box-containing 3 (Asb3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Asb3 (65257)
Length:
3225
CDS:
186..1763

Additional Resources:

NCBI RefSeq record:
NM_023906.3
NBCI Gene record:
Asb3 (65257)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023906.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084678 CAGGTCCTTTAATTCTGTTTA pLKO.1 1766 3UTR 100% 13.200 18.480 N Asb3 n/a
2 TRCN0000331506 CAGGTCCTTTAATTCTGTTTA pLKO_005 1766 3UTR 100% 13.200 18.480 N Asb3 n/a
3 TRCN0000304459 TTGTTAATACCACGTACTAAC pLKO_005 978 CDS 100% 10.800 15.120 N Asb3 n/a
4 TRCN0000304460 GACAATTGGCAATTACCTATT pLKO_005 918 CDS 100% 10.800 8.640 N Asb3 n/a
5 TRCN0000084679 GCTGGATTTGACCCATTGATT pLKO.1 1386 CDS 100% 5.625 3.938 N Asb3 n/a
6 TRCN0000084680 CCTTTGTTTATTGCTGCACAA pLKO.1 828 CDS 100% 4.050 2.835 N Asb3 n/a
7 TRCN0000084681 GCAGCTAATCAGGATGGAGAA pLKO.1 1725 CDS 100% 4.050 2.835 N Asb3 n/a
8 TRCN0000301825 GCAGCTAATCAGGATGGAGAA pLKO_005 1725 CDS 100% 4.050 2.835 N Asb3 n/a
9 TRCN0000084682 CCAGGGAAATGCTGAGACTAT pLKO.1 650 CDS 100% 4.950 2.970 N Asb3 n/a
10 TRCN0000301826 CCAGGGAAATGCTGAGACTAT pLKO_005 650 CDS 100% 4.950 2.970 N Asb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023906.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03223 pDONR223 100% 85.1% 82.6% None (many diffs) n/a
2 ccsbBroad304_03223 pLX_304 0% 85.1% 82.6% V5 (many diffs) n/a
3 TRCN0000474116 CGATTCGGATACCGTCAAGCACCT pLX_317 29.9% 85.1% 82.6% V5 (many diffs) n/a
Download CSV