Transcript: Human NM_024055.5

Homo sapiens solute carrier family 30 member 5 (SLC30A5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SLC30A5 (64924)
Length:
1294
CDS:
243..599

Additional Resources:

NCBI RefSeq record:
NM_024055.5
NBCI Gene record:
SLC30A5 (64924)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024055.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304224 ACGTACCCAGCGCTCGATTAA pLKO_005 310 CDS 100% 13.200 18.480 N SLC30A5 n/a
2 TRCN0000042824 CCAGATAATTGGATCACTAAA pLKO.1 512 CDS 100% 13.200 18.480 N SLC30A5 n/a
3 TRCN0000042826 CGAATCATATGATCTCCTAAA pLKO.1 386 CDS 100% 0.000 0.000 N SLC30A5 n/a
4 TRCN0000300935 CGAATCATATGATCTCCTAAA pLKO_005 386 CDS 100% 0.000 0.000 N SLC30A5 n/a
5 TRCN0000042827 CTATTACCAAACACCAGATAA pLKO.1 499 CDS 100% 13.200 9.240 N SLC30A5 n/a
6 TRCN0000331678 CTATTACCAAACACCAGATAA pLKO_005 499 CDS 100% 13.200 9.240 N SLC30A5 n/a
7 TRCN0000304160 GACTTAGTCAAGGGATCTTAT pLKO_005 1025 3UTR 100% 13.200 9.240 N SLC30A5 n/a
8 TRCN0000042825 GTTCACATTGTTCAGTTCATT pLKO.1 411 CDS 100% 5.625 3.938 N SLC30A5 n/a
9 TRCN0000300936 GTTCACATTGTTCAGTTCATT pLKO_005 411 CDS 100% 5.625 3.938 N SLC30A5 n/a
10 TRCN0000042823 CCTCACAAAGTGCTAGGATTA pLKO.1 950 3UTR 100% 10.800 5.400 Y SLC30A5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024055.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03984 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03984 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481364 CACACGAACGTTTACTGCCGCCAT pLX_317 100% 100% 100% V5 n/a
Download CSV