Transcript: Human NM_024093.3

Homo sapiens chromosome 2 open reading frame 49 (C2orf49), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
C2orf49 (79074)
Length:
4587
CDS:
49..747

Additional Resources:

NCBI RefSeq record:
NM_024093.3
NBCI Gene record:
C2orf49 (79074)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024093.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005770 CCATGACTTAACGCATAGGAA pLKO.1 570 CDS 100% 3.000 4.200 N C2orf49 n/a
2 TRCN0000005768 CCCTCATCGTATTTGATGGAA pLKO.1 347 CDS 100% 3.000 4.200 N C2orf49 n/a
3 TRCN0000436326 AGAGGGATTTGCCGAAGAATA pLKO_005 233 CDS 100% 13.200 9.240 N C2orf49 n/a
4 TRCN0000435369 GAACTACTCCAGTGAAGTTAA pLKO_005 635 CDS 100% 13.200 9.240 N C2orf49 n/a
5 TRCN0000418813 GACAGTCTTACTGACCTTTAT pLKO_005 187 CDS 100% 13.200 9.240 N C2orf49 n/a
6 TRCN0000005767 CGCTAAACAGAACCATGACTT pLKO.1 558 CDS 100% 4.950 3.465 N C2orf49 n/a
7 TRCN0000005769 GCAGGCAAGCTTTACCAGTAA pLKO.1 438 CDS 100% 4.950 3.465 N C2orf49 n/a
8 TRCN0000005766 TGTAAATATACTGTAACTGTA pLKO.1 765 3UTR 100% 0.000 0.000 N C2orf49 n/a
9 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 1076 3UTR 100% 4.950 2.475 Y NPHS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024093.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04039 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04039 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492228 GAGGCCCTGTACATACAGATGGTA pLX_317 67.8% 100% 100% V5 n/a
Download CSV