Transcript: Human NM_024103.3

Homo sapiens solute carrier family 25 member 23 (SLC25A23), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SLC25A23 (79085)
Length:
3482
CDS:
165..1571

Additional Resources:

NCBI RefSeq record:
NM_024103.3
NBCI Gene record:
SLC25A23 (79085)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024103.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431841 CCATAACTGTGGATCCCTTAC pLKO_005 1826 3UTR 100% 6.000 8.400 N SLC25A23 n/a
2 TRCN0000044864 CGAGTCAGCTATCAAGTTCAT pLKO.1 926 CDS 100% 4.950 6.930 N SLC25A23 n/a
3 TRCN0000044866 CGTCTACGAGACTCTGAAGAA pLKO.1 1226 CDS 100% 4.950 6.930 N SLC25A23 n/a
4 TRCN0000423129 GCTTCGAAGCATGGTCCTTGA pLKO_005 848 CDS 100% 4.050 5.670 N SLC25A23 n/a
5 TRCN0000413265 GACCATTGACTGGCAAGAATG pLKO_005 557 CDS 100% 10.800 7.560 N SLC25A23 n/a
6 TRCN0000415302 TCTGAGATCCAACAGAGTTTC pLKO_005 462 CDS 100% 10.800 7.560 N SLC25A23 n/a
7 TRCN0000044867 CTGCTCATGTTTCACAGTCTT pLKO.1 411 CDS 100% 4.950 3.465 N SLC25A23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024103.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12542 pDONR223 100% 82.8% 76.2% None (many diffs) n/a
2 ccsbBroad304_12542 pLX_304 0% 82.8% 76.2% V5 (many diffs) n/a
3 TRCN0000478570 CGAAACTACGGCTGTCCGCAGGTA pLX_317 19% 82.8% 76.2% V5 (many diffs) n/a
Download CSV