Transcript: Mouse NM_024173.2

Mus musculus ATPase, H+ transporting, lysosomal V1 subunit G1 (Atp6v1g1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Atp6v1g1 (66290)
Length:
1109
CDS:
154..510

Additional Resources:

NCBI RefSeq record:
NM_024173.2
NBCI Gene record:
Atp6v1g1 (66290)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024173.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101525 GCTATTAGTAACTCCTATGAA pLKO.1 895 3UTR 100% 5.625 7.875 N Atp6v1g1 n/a
2 TRCN0000101526 CCAGAACTACTTCGAGCAGAA pLKO.1 405 CDS 100% 4.050 5.670 N Atp6v1g1 n/a
3 TRCN0000101527 ACAGGGATGAAGTCCTGGATA pLKO.1 425 CDS 100% 4.950 3.465 N Atp6v1g1 n/a
4 TRCN0000070298 CCAGGCTGAAATTGAACAGTA pLKO.1 273 CDS 100% 4.950 3.465 N LOC435513 n/a
5 TRCN0000101528 CTGGATAACCTCTTGGCCTTT pLKO.1 439 CDS 100% 4.050 2.835 N Atp6v1g1 n/a
6 TRCN0000101529 CGGAGGCTGAAGCAGGCCAAA pLKO.1 244 CDS 100% 0.000 0.000 N Atp6v1g1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024173.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07443 pDONR223 100% 91.2% 94.9% None (many diffs) n/a
2 ccsbBroad304_07443 pLX_304 0% 91.2% 94.9% V5 (many diffs) n/a
3 TRCN0000478630 GTTCACCTTGATCCTGGTGCCAGA pLX_317 100% 91.2% 94.9% V5 (many diffs) n/a
4 ccsbBroadEn_11388 pDONR223 100% 65.8% 67.7% None (many diffs) n/a
5 ccsbBroad304_11388 pLX_304 0% 65.8% 67.7% V5 (many diffs) n/a
Download CSV