Transcript: Mouse NM_024184.2

Mus musculus anti-silencing function 1B histone chaperone (Asf1b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Asf1b (66929)
Length:
1599
CDS:
136..744

Additional Resources:

NCBI RefSeq record:
NM_024184.2
NBCI Gene record:
Asf1b (66929)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245017 CTGGAGTGGAAGATCATTTAT pLKO_005 247 CDS 100% 15.000 10.500 N ASF1B n/a
2 TRCN0000108961 CCTCAGTTGCACTCCTGTTAA pLKO.1 660 CDS 100% 13.200 9.240 N Asf1b n/a
3 TRCN0000108962 CCTGGAGTGGAAGATCATTTA pLKO.1 246 CDS 100% 13.200 9.240 N Asf1b n/a
4 TRCN0000108964 GTGGGCTACTATGTCAACAAT pLKO.1 460 CDS 100% 5.625 3.938 N Asf1b n/a
5 TRCN0000108963 TGTGGGCTACTATGTCAACAA pLKO.1 459 CDS 100% 4.950 3.465 N Asf1b n/a
6 TRCN0000108960 CCAGCTCAATACAATGGCTAT pLKO.1 1155 3UTR 100% 4.050 2.835 N Asf1b n/a
7 TRCN0000382013 TCATCACCTGCACCTACCATG pLKO_005 422 CDS 100% 4.050 2.835 N ASF1B n/a
8 TRCN0000074225 GAGTGGAAGATCATTTATGTT pLKO.1 250 CDS 100% 5.625 7.875 N ASF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03641 pDONR223 100% 87.8% 91.5% None (many diffs) n/a
2 ccsbBroad304_03641 pLX_304 0% 87.8% 91.5% V5 (many diffs) n/a
3 TRCN0000468671 TTGACAGTTCTTTACTCCCTGGCG pLX_317 62.1% 87.8% 91.5% V5 (many diffs) n/a
Download CSV