Transcript: Mouse NM_024200.4

Mus musculus mitofusin 1 (Mfn1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mfn1 (67414)
Length:
4531
CDS:
222..2447

Additional Resources:

NCBI RefSeq record:
NM_024200.4
NBCI Gene record:
Mfn1 (67414)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024200.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348627 TACGGAGCTCTGTACCTTTAT pLKO_005 2085 CDS 100% 13.200 18.480 N Mfn1 n/a
2 TRCN0000081400 GCAAGATTACAGGAGTTTCAA pLKO.1 1155 CDS 100% 5.625 7.875 N Mfn1 n/a
3 TRCN0000081398 GCCTTGTCTTAGCATTAGTTT pLKO.1 2606 3UTR 100% 5.625 7.875 N Mfn1 n/a
4 TRCN0000317700 GCCTTGTCTTAGCATTAGTTT pLKO_005 2606 3UTR 100% 5.625 7.875 N Mfn1 n/a
5 TRCN0000081399 CGGTGTACCAATGAAGTCAAT pLKO.1 1599 CDS 100% 4.950 6.930 N Mfn1 n/a
6 TRCN0000081402 CCCAGTGTACTGAAAGTGTAT pLKO.1 1524 CDS 100% 4.950 3.960 N Mfn1 n/a
7 TRCN0000317698 CCCAGTGTACTGAAAGTGTAT pLKO_005 1524 CDS 100% 4.950 3.960 N Mfn1 n/a
8 TRCN0000319414 ATGCAATGCTGTGGGATAAAG pLKO_005 499 CDS 100% 13.200 9.240 N Mfn1 n/a
9 TRCN0000081401 GCGTTTAAGCAGCAGTTTGTA pLKO.1 2142 CDS 100% 5.625 3.938 N Mfn1 n/a
10 TRCN0000317619 GCGTTTAAGCAGCAGTTTGTA pLKO_005 2142 CDS 100% 5.625 3.938 N Mfn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024200.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03626 pDONR223 100% 86.6% 90.5% None (many diffs) n/a
2 ccsbBroad304_03626 pLX_304 0% 86.6% 90.5% V5 (many diffs) n/a
3 TRCN0000478631 TTTCTACTTTGAACGTAGCCTTAA pLX_317 13.9% 86.6% 90.5% V5 (many diffs) n/a
Download CSV