Transcript: Mouse NM_024219.1

Mus musculus heat shock factor binding protein 1 (Hsbp1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Hsbp1 (68196)
Length:
1178
CDS:
39..269

Additional Resources:

NCBI RefSeq record:
NM_024219.1
NBCI Gene record:
Hsbp1 (68196)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095469 CGGTACTGAATCCAGAATGTT pLKO.1 277 3UTR 100% 5.625 7.875 N Hsbp1 n/a
2 TRCN0000334817 CGGTACTGAATCCAGAATGTT pLKO_005 277 3UTR 100% 5.625 7.875 N Hsbp1 n/a
3 TRCN0000095472 GATGACATGAGCAGTCGGATT pLKO.1 153 CDS 100% 4.050 5.670 N Hsbp1 n/a
4 TRCN0000095470 GACCAGATCATCGGAAGGATA pLKO.1 132 CDS 100% 4.950 3.465 N Hsbp1 n/a
5 TRCN0000334897 GACCAGATCATCGGAAGGATA pLKO_005 132 CDS 100% 4.950 3.465 N Hsbp1 n/a
6 TRCN0000095471 GCAGCAGATGCAAGACAAGTT pLKO.1 98 CDS 100% 4.950 3.465 N Hsbp1 n/a
7 TRCN0000334896 GCAGCAGATGCAAGACAAGTT pLKO_005 98 CDS 100% 4.950 3.465 N Hsbp1 n/a
8 TRCN0000095473 CCTGGAGAAGAATATCGCTGA pLKO.1 179 CDS 100% 2.160 1.512 N Hsbp1 n/a
9 TRCN0000334898 CCTGGAGAAGAATATCGCTGA pLKO_005 179 CDS 100% 2.160 1.512 N Hsbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00789 pDONR223 100% 85% 88.1% None (many diffs) n/a
2 ccsbBroad304_00789 pLX_304 0% 85% 88.1% V5 (many diffs) n/a
3 TRCN0000475362 TGGCGCATCCTAAAGTGTAAGATT pLX_317 100% 85% 88.1% V5 (many diffs) n/a
Download CSV