Transcript: Human NM_024329.6

Homo sapiens EF-hand domain family member D2 (EFHD2), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
EFHD2 (79180)
Length:
2422
CDS:
85..807

Additional Resources:

NCBI RefSeq record:
NM_024329.6
NBCI Gene record:
EFHD2 (79180)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024329.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149935 GCGTCTTCCATCTACTGAAAT pLKO.1 1361 3UTR 100% 13.200 18.480 N EFHD2 n/a
2 TRCN0000448523 TCTGACGGGACCACTACTAAA pLKO_005 896 3UTR 100% 13.200 18.480 N EFHD2 n/a
3 TRCN0000147514 GTGCTTTAAGTGTGTTTGCAT pLKO.1 1722 3UTR 100% 3.000 2.400 N EFHD2 n/a
4 TRCN0000147629 GCCTTAGAATCTGCAGAAATT pLKO.1 2172 3UTR 100% 13.200 9.240 N EFHD2 n/a
5 TRCN0000440849 AGTTCTCCAGGAAGCAGATCA pLKO_005 347 CDS 100% 4.950 3.465 N EFHD2 n/a
6 TRCN0000110681 GAGAAGATGTTCAAGCAGTAT pLKO.1 376 CDS 100% 4.950 3.465 N Efhd2 n/a
7 TRCN0000147326 GAGAAGATGTTCAAGCAGTAT pLKO.1 376 CDS 100% 4.950 3.465 N EFHD2 n/a
8 TRCN0000149163 GCAACTTTCAGTGTGTGTCAT pLKO.1 2053 3UTR 100% 4.950 3.465 N EFHD2 n/a
9 TRCN0000449881 CTGAATCCTTGCCTGTGTCTG pLKO_005 879 3UTR 100% 4.050 2.835 N EFHD2 n/a
10 TRCN0000110684 GTTCAAGGAGTTCTCCAGGAA pLKO.1 339 CDS 100% 2.640 1.848 N Efhd2 n/a
11 TRCN0000149643 GATCAAGGACATGGAGAAGAT pLKO.1 363 CDS 100% 4.950 2.970 N EFHD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024329.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.