Transcript: Human NM_024333.3

Homo sapiens fibronectin type III and SPRY domain containing 1 (FSD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
FSD1 (79187)
Length:
1833
CDS:
150..1640

Additional Resources:

NCBI RefSeq record:
NM_024333.3
NBCI Gene record:
FSD1 (79187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181207 CCAAACAAGTGCTGCACACTT pLKO.1 1468 CDS 100% 0.495 0.693 N FSD1 n/a
2 TRCN0000148121 GAAATACATGAACTTCCGTGT pLKO.1 866 CDS 100% 2.160 1.728 N FSD1 n/a
3 TRCN0000437237 GGTGCCTGCACGTCAACAATT pLKO_005 1321 CDS 100% 13.200 9.240 N FSD1 n/a
4 TRCN0000147791 GAAGGCATGCTTATGAAGATA pLKO.1 336 CDS 100% 5.625 3.938 N FSD1 n/a
5 TRCN0000179718 GCTGCCAAGCAAATCAAAGAT pLKO.1 495 CDS 100% 5.625 3.938 N FSD1 n/a
6 TRCN0000447189 GTACACCCTGACAGGTCTCAA pLKO_005 836 CDS 100% 4.950 3.465 N FSD1 n/a
7 TRCN0000180274 CCTGAAACAGATGCTGCTGAA pLKO.1 233 CDS 100% 4.050 2.430 N FSD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12557 pDONR223 100% 62.2% 62.2% None 1_561del n/a
2 ccsbBroad304_12557 pLX_304 0% 62.2% 62.2% V5 1_561del n/a
3 TRCN0000471389 AGCTGGATCATAGTTCCGTCGTGC pLX_317 49.9% 62.2% 62.2% V5 1_561del n/a
Download CSV