Transcript: Mouse NM_024468.2

Mus musculus tripartite motif-containing 39 (Trim39), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Trim39 (79263)
Length:
3085
CDS:
118..1584

Additional Resources:

NCBI RefSeq record:
NM_024468.2
NBCI Gene record:
Trim39 (79263)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423910 GTATACCTCGGTGTCGGAAAG pLKO_005 1995 3UTR 100% 6.000 8.400 N Trim39 n/a
2 TRCN0000037283 CAGGACATTCTACAGCGACTT pLKO.1 775 CDS 100% 4.050 3.240 N Trim39 n/a
3 TRCN0000438509 CCTAACTGGCCTGCTAGAATA pLKO_005 1636 3UTR 100% 13.200 9.240 N Trim39 n/a
4 TRCN0000377320 GAAGAATGCTGCACCACTTAC pLKO_005 1536 CDS 100% 10.800 7.560 N TRIM39 n/a
5 TRCN0000037280 GCTAGGCAGTATGGTGGAAAT pLKO.1 366 CDS 100% 10.800 7.560 N Trim39 n/a
6 TRCN0000037279 GCCTGGGTAATCTTCACACAA pLKO.1 2910 3UTR 100% 4.950 3.465 N Trim39 n/a
7 TRCN0000037281 GCGTCAAGTTTGTGGAGACAA pLKO.1 1100 CDS 100% 4.950 3.465 N Trim39 n/a
8 TRCN0000033879 GTAGGCATATTCCTAGACTAT pLKO.1 1399 CDS 100% 4.950 3.465 N TRIM39 n/a
9 TRCN0000037282 CCGTTCACATATCTACACCTT pLKO.1 1455 CDS 100% 2.640 1.848 N Trim39 n/a
10 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 2431 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08648 pDONR223 100% 90.4% 97.5% None (many diffs) n/a
2 ccsbBroad304_08648 pLX_304 0% 90.4% 97.5% V5 (many diffs) n/a
3 TRCN0000470388 GGCACTGGGCCTCTGGCTAGAACC pLX_317 31.6% 90.4% 97.5% V5 (many diffs) n/a
4 ccsbBroadEn_03734 pDONR223 100% 90.4% 97.5% None (many diffs) n/a
5 ccsbBroad304_03734 pLX_304 0% 90.4% 97.5% V5 (many diffs) n/a
6 TRCN0000473810 ACTGCTACCCACAGAAGCTTTACC pLX_317 26.2% 90.4% 97.5% V5 (many diffs) n/a
Download CSV