Transcript: Human NM_024505.4

Homo sapiens NADPH oxidase 5 (NOX5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NOX5 (79400)
Length:
8405
CDS:
42..2339

Additional Resources:

NCBI RefSeq record:
NM_024505.4
NBCI Gene record:
NOX5 (79400)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024505.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046099 CCCTATTTGACTCCGATAGAA pLKO.1 241 CDS 100% 5.625 7.875 N NOX5 n/a
2 TRCN0000046098 CGTGTGCATCATGGAAGTCAA pLKO.1 1376 CDS 100% 4.950 6.930 N NOX5 n/a
3 TRCN0000046101 GCCACTTTGAGGTGTTCTATT pLKO.1 1219 CDS 100% 13.200 9.240 N NOX5 n/a
4 TRCN0000046100 GCTCCATAAGGTGGACTTTAT pLKO.1 1931 CDS 100% 13.200 9.240 N NOX5 n/a
5 TRCN0000046102 GCATGTGAAAGAGTCCTTCTT pLKO.1 203 CDS 100% 4.950 3.465 N NOX5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024505.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12564 pDONR223 100% 93.8% 93.8% None (many diffs) n/a
2 ccsbBroad304_12564 pLX_304 0% 93.8% 93.8% V5 (many diffs) n/a
3 TRCN0000481579 ACCGAGGAACCCACGTTACATCCG pLX_317 22.7% 93.8% 93.8% V5 (many diffs) n/a
Download CSV