Transcript: Human NM_024506.5

Homo sapiens galactosidase beta 1 like (GLB1L), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
GLB1L (79411)
Length:
2713
CDS:
275..2239

Additional Resources:

NCBI RefSeq record:
NM_024506.5
NBCI Gene record:
GLB1L (79411)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024506.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370163 ATGTTGTACCGAACCTATATG pLKO_005 1514 CDS 100% 13.200 10.560 N GLB1L n/a
2 TRCN0000155788 CTTCCGATTACTACCAGCTAT pLKO.1 1241 CDS 100% 4.950 3.465 N GLB1L n/a
3 TRCN0000154750 GCCATTGGTAAACTCTGAGTA pLKO.1 1048 CDS 100% 4.950 3.465 N GLB1L n/a
4 TRCN0000353783 GCCATTGGTAAACTCTGAGTA pLKO_005 1048 CDS 100% 4.950 3.465 N GLB1L n/a
5 TRCN0000156803 GTGGATGATGTTCCCTCTGAA pLKO.1 1792 CDS 100% 4.950 3.465 N GLB1L n/a
6 TRCN0000331009 GTGGATGATGTTCCCTCTGAA pLKO_005 1792 CDS 100% 4.950 3.465 N GLB1L n/a
7 TRCN0000157870 CTTCAGCTACATGAGGCACTT pLKO.1 856 CDS 100% 4.050 2.835 N GLB1L n/a
8 TRCN0000331008 CTTCAGCTACATGAGGCACTT pLKO_005 856 CDS 100% 4.050 2.835 N GLB1L n/a
9 TRCN0000157496 GATTACCTGAGGTCAGGACTT pLKO.1 2304 3UTR 100% 4.050 2.430 N GLB1L n/a
10 TRCN0000353784 GATTACCTGAGGTCAGGACTT pLKO_005 2304 3UTR 100% 4.050 2.430 N GLB1L n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2432 3UTR 100% 10.800 5.400 Y SMIM11A n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2266 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024506.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12565 pDONR223 98.8% 62.8% 62.8% None 1_729del n/a
2 ccsbBroad304_12565 pLX_304 0% 62.8% 62.8% V5 (not translated due to prior stop codon) 1_729del n/a
Download CSV