Transcript: Human NM_024522.3

Homo sapiens sodium/potassium transporting ATPase interacting 1 (NKAIN1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
NKAIN1 (79570)
Length:
2922
CDS:
341..964

Additional Resources:

NCBI RefSeq record:
NM_024522.3
NBCI Gene record:
NKAIN1 (79570)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024522.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122337 CGGCTTTGACTCCTACGGATA pLKO.1 886 CDS 100% 4.050 5.670 N NKAIN1 n/a
2 TRCN0000141830 GAAGACGTCGCATTTACAGCT pLKO.1 919 CDS 100% 2.640 3.696 N NKAIN1 n/a
3 TRCN0000144962 GCTGGAATGCATTTATCATCT pLKO.1 561 CDS 100% 4.950 3.960 N NKAIN1 n/a
4 TRCN0000419902 TGTGAACTAGGAGCAGGATTC pLKO_005 1391 3UTR 100% 6.000 4.200 N NKAIN1 n/a
5 TRCN0000143173 GCCTTGAACACAGTGTACTTT pLKO.1 1656 3UTR 100% 5.625 3.938 N NKAIN1 n/a
6 TRCN0000144636 GCATTTATCATCTGCTTCTAC pLKO.1 569 CDS 100% 4.950 3.465 N NKAIN1 n/a
7 TRCN0000447120 TTCGCCTGCTACGTGAGCAAA pLKO_005 827 CDS 100% 4.950 3.465 N NKAIN1 n/a
8 TRCN0000142886 CCTCCAATCTATCATTCCCTA pLKO.1 2509 3UTR 100% 2.640 1.848 N NKAIN1 n/a
9 TRCN0000141565 CACCATGTCATCTCTGTCACT pLKO.1 728 CDS 100% 2.640 1.584 N NKAIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024522.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12568 pDONR223 100% 78.7% 78.7% None 1_132del n/a
2 ccsbBroad304_12568 pLX_304 0% 78.7% 78.7% V5 1_132del n/a
3 TRCN0000469952 ACTACGCCCGTAATATCTTGTCGC pLX_317 87.5% 78.7% 78.7% V5 1_132del n/a
Download CSV