Transcript: Human NM_024562.2

Homo sapiens transport and golgi organization 6 homolog (TANGO6), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
TANGO6 (79613)
Length:
4893
CDS:
88..3372

Additional Resources:

NCBI RefSeq record:
NM_024562.2
NBCI Gene record:
TANGO6 (79613)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024562.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254334 CGAGTGACTGAAGGATCTATA pLKO_005 4538 3UTR 100% 13.200 18.480 N TANGO6 n/a
2 TRCN0000254332 GCCGGACTTGTTGGCTCAATA pLKO_005 2829 CDS 100% 13.200 18.480 N TANGO6 n/a
3 TRCN0000254333 CATGCGGTCTGGATCGGATTT pLKO_005 128 CDS 100% 10.800 15.120 N TANGO6 n/a
4 TRCN0000254335 GATCCGCCTTGCAGCTAATTT pLKO_005 414 CDS 100% 15.000 12.000 N TANGO6 n/a
5 TRCN0000265505 AGAATGTCTGAGCAGATATTC pLKO_005 2044 CDS 100% 13.200 9.240 N TANGO6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024562.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14263 pDONR223 100% 56.9% 56.8% None 1_1413del;3281C>A n/a
2 ccsbBroad304_14263 pLX_304 0% 56.9% 56.8% V5 1_1413del;3281C>A n/a
3 TRCN0000475062 CCACATTCCCAGTGGACGGGTCTG pLX_317 16.6% 56.9% 56.8% V5 1_1413del;3281C>A n/a
Download CSV