Transcript: Human NM_024585.4

Homo sapiens armadillo repeat containing 7 (ARMC7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ARMC7 (79637)
Length:
2151
CDS:
321..917

Additional Resources:

NCBI RefSeq record:
NM_024585.4
NBCI Gene record:
ARMC7 (79637)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024585.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140332 CATCTGAAAGGCGGGTTCTTT pLKO.1 1024 3UTR 100% 5.625 7.875 N ARMC7 n/a
2 TRCN0000278894 CATCTGAAAGGCGGGTTCTTT pLKO_005 1024 3UTR 100% 5.625 7.875 N ARMC7 n/a
3 TRCN0000139475 CCCTTAACAGAAGTGTCTGGA pLKO.1 1306 3UTR 100% 2.640 2.112 N ARMC7 n/a
4 TRCN0000141082 CTGCAGGAAATCAGGGATTAT pLKO.1 1285 3UTR 100% 13.200 9.240 N ARMC7 n/a
5 TRCN0000278893 CTGCAGGAAATCAGGGATTAT pLKO_005 1285 3UTR 100% 13.200 9.240 N ARMC7 n/a
6 TRCN0000141223 CCATGACTCCAAGATGAAGAT pLKO.1 1525 3UTR 100% 4.950 3.465 N ARMC7 n/a
7 TRCN0000139759 CTGGCACTCTCAATCCTACAT pLKO.1 1143 3UTR 100% 4.950 3.465 N ARMC7 n/a
8 TRCN0000278979 CTGGCACTCTCAATCCTACAT pLKO_005 1143 3UTR 100% 4.950 3.465 N ARMC7 n/a
9 TRCN0000122835 GTCTGCCATCACCACGCTCAT pLKO.1 668 CDS 100% 1.350 0.945 N ARMC7 n/a
10 TRCN0000139889 GCTGCAGGAAATCAGGGATTA pLKO.1 1284 3UTR 100% 10.800 6.480 N ARMC7 n/a
11 TRCN0000141469 CAGAAGTGTCTGGAGTAGTTT pLKO.1 1313 3UTR 100% 5.625 3.375 N ARMC7 n/a
12 TRCN0000278965 CAGAAGTGTCTGGAGTAGTTT pLKO_005 1313 3UTR 100% 5.625 3.375 N ARMC7 n/a
13 TRCN0000139716 CCTCTGCTGTCACTCAATGAT pLKO.1 1708 3UTR 100% 5.625 3.375 N ARMC7 n/a
14 TRCN0000278966 CCTCTGCTGTCACTCAATGAT pLKO_005 1708 3UTR 100% 5.625 3.375 N ARMC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024585.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08940 pDONR223 100% 99.8% 99.4% None 593G>T n/a
2 ccsbBroad304_08940 pLX_304 0% 99.8% 99.4% V5 593G>T n/a
3 TRCN0000474762 CAGATGATAGGCGCTACTCTTAAC pLX_317 90.3% 99.8% 99.4% V5 593G>T n/a
Download CSV